Чем отличается швеллер п от у: Чем отличается швеллер У от П

Содержание

В чем разница между швеллером «У» и «П»?

Швеллер представляет собой небольшой предмет из металла, поперечное сечение которого образует букву «П». Поперечный срез стенки является перемычкой, а ножки – буквой «П». Основным предназначением является поддержка опорного механизма в строении, в производстве металлических конструкций в сфере строительства и промышленного производства. Конструкция изделия позволяет обеспечить высокую прочность к вертикальным нагрузкам.

Характеристика, классификация и различие изделий

Швеллер изготавливается с помощью прокатки металлических заготовок, для этого используют особые профессиональные станки. Для изготовления продукции используют только высококачественную сталь. Разделяют их по специальным видам:

  • для вагоностроения;
  • для автомобильного промышленного комплекса;
  • обычный.

По классу прочности их делят на:

  • высокий класса А;
  • повышенная точность класса Б;
  • обычный класс В.

По методу изготовления изделие делится:

  • стальные горячекатаные;
  • стальные гнутые равнополочные;
  • стальные гнутые неравнополочные;
  • стальные специальные.

В зависимости от точной прокатки, изделие различают:

  • У – с уклоном по внутренней грани полки;
  • П – параллельная грань полок;
  • Л – параллельная полка, легкая серия;
  • С – специальная.

Отличие швеллера «У» и «П» заключается в уклоне внутренних углов изделия. Изделие «У» имеет внутренний угол, сглаженный уклон, равный 90 градусов (чаще всего не выдерживает такой величины). Изделие «П» имеет внутренний угол с выдержанным углом 90 градусов.

Горячекатаное изделие изготавливают с помощью горячего проката металла. Изделие производится согласно ГОСТу 19425-74, осуществляют его в разрезе по сферам отраслей. Чаще всего его используют в сфере вагоностроения, например, для вагонеток. Тип и вес у изделий разные, средний вес П-изделия варьируется от 4,8 до 20 кг, вес измеряется в расчете на 1 метр изделия. Ширина изделия колеблется от 5 до 10 сантиметров, а длина – от 2 до 12 метров. В соответствии с ГОСТом могут быть весовые отклонения, не более 5% от физического веса.

Читайте также: Чем выгоднее утеплить крышу частного дома

Размер и тип изделия нанесен на изделие, промаркирован, состоит из цифрового и буквенного значения. Цифра обозначает расстояние между краями и гранью изделия, а буква указывает на то, под каким углом расположены полки изделия. Стоит отметить, что в самом изделии присутствует низкое содержание углерода и марганца, что позволяет сделать изделие более устойчивым и прочным к низким температурам. Эти качества дают изделию возможность не только служить долго, но сэкономить и увеличить надежность в эксплуатации конструкций. При выборе необходимого изделия специалисты советуют изучить классификационную таблицу.

Популярные виды изделий

Изделие типа 10: широко применяется в строительной, машиностроительной сферах; отличается высокими механическими качествами, применяется для больших стержневых конструкций, опорных, несущих механизмов в строительстве различных промышленных объектов.

Изделие типа 14: считается самым востребованным изделием в строительстве; широко применяется в строительстве различных конструкций с тяжелым армированием несущих деталей; задействован в строительной и машиностроительной сфере, бывает обычной точности и повышенной.

Изделие типа 20: благодаря своей высокой прочности и надежности, его используют в сложных конструкциях с высокой динамической, статической и циклической нагрузками. Его основная функция – это несущий механизм для усиления мостов, сложного армирования перекрытий в многоэтажных дома и в кровельных механизмах.

Сфера применения

В последнее время это изделие получило большую популярность в использовании. И это неудивительно. В строительной сфере это изделие просто незаменимо, оно дает не только прочность и надежность конструкции в целом, но и безопасность. При введении в эксплуатацию любого строительного объекта школа, административное здание или собственный дом, всегда используется специальный металлический уголок или швеллер. Непосредственно в самой конструкции его задача обеспечивать мощную поддержку для всех сложных частей. Специалисты советуют использовать его и в укладке фундамента, что дает большую прочность будущему объекту.

Еще это изделие широко применяют для осуществления перекрытий каркасов и для оборудования пандусов. Поэтому для обеспечения жесткости и устойчивости строения без него не обойтись. Помимо строительной сферы, он используется в автомобильной и вагоностроительной промышленности, в архитектурном и станкостроении. Благодаря тому, что изделие имеет прочный осевой изгиб, оно нашло свое применение практически во всех отраслях экономики.

Приобрести такое изделие можно в любом металлопрокатном производстве или металлобазе.

Швеллер — классификация и область применения

Швеллер — это металлическое изделие, в поперечном сечении образующее букву «П». У швеллера различают стенки и полку. На поперечном срезе стенкой называют «перемычку», а полками — ножки буквы «П». Важнейшими характеристиками полок и стенки являются типоразмеры. Так под высотой швеллера понимают высоту его полок.

Стальной швеллер изготавливают из стального проката способом горячей прокатки заготовок на сортовых станах. Швеллер изготавливают с уклоном внутренних граней полок и с параллельными полками. Номер швеллера указывает его высоту.

Характеристика сортамента и классификация швеллера

Швеллер гнутый изготавливается из рулонной горячекатаной и холоднокатаной углеродистой стали обыкновенного качества, качественной углеродистой и низколегированной стали.

По способу изготовления швеллеры делятся на следующие виды:

  • Швеллеры стальные горячекатаные;
  • Швеллеры стальные специальные;
  • Швеллеры стальные гнутые равнополочные;
  • Швеллеры стальные гнутые неравнополочные.

В соответствие со своим назначением швеллер подразделяется на:

  • Обычный, швеллер широкого применения, сортаментом регламентируемым требованиями ГОСТ 8240-89;
  • Специальный, предназначенный для автомобильной промышленности, сортамент по ГОСТ 19425-74;
  • Специальный для вагоностроения сортамент ГОСТ 5267.1-90.

Горячекатаный швеллер — производится путем горячего проката металла. Горячекатаный швеллер специального назначения изготавливается согласно ГОСТ 19425-74 и специально разработан по отраслевым запросам. Чаще всего такой швеллер востребован в вагоностроении, так как обладает необходимыми измененными геометрическими характеристиками.

Например, стальной горячекатаный швеллер с отогнутой полкой для вагонеток (производится по ГОСТ 21026-75), отогнутая вверх полка которого имеет отклонение от ширины полки 6-10%. Достоинство такого швеллера в том, что изготавливаясь из легированной стали, он не имеет ограничений по свариванию.

Швеллер стальной горячекатаный

изготавливается согласно ГОСТ 535-88 в двух видах:

  • Швеллер с уклоном внутренних граней полок: 5, 6.5, 8, 10, 12, 14, 16, 16а, 18, 18а, 20, 22, 24, 27, 30, 33, 36, 40;
  • Швеллер с параллельными гранями полок П: 5П, 6.5П, 8П, 10П, 12П, 14П, 16П, 16аП, 18П, 18аП, 20П, 22П, 24П, 27П, 30П, 33П, 36П, 40П;

Швеллер с уклоном граней — изготавливается швеллер горячекатаный с уклоном граней согласно ГОСТ 8240-97 и имеет уклон противоположных полок от 4% до 10%. Маркируется такой швеллер буквой «У» и цифрой перед ней, определяющей расстояние между полками в сантиметрах.

Швеллер с параллельными гранями — отличается такой швеллер от горячекатаного с уклоном граней полок тем, что имеет параллельные грани. Изготавливается так же по ГОСТ 8240-97. Маркируется такой швеллер буквой по типу («П» — с параллельными гранями, «Э» — экономичный, «Л» — лёгкий) и цифрой, определяющей расстояние между полками в сантиметрах.

Швеллер с уклоном гранейШвеллер с параллельными гранями

В зависимости от точности прокатки, швеллер горячекатаный подразделяют:

  • Высокой точности — «А»;
  • Обычной точности — «В».

Швеллер специальный предназначен для применения в автомобильной промышленности (ГОСТ 19425-74) и в вагоностроении (ГОСТ 5267.1-90).

В зависимости от точности прокатки, специальный швеллер подразделяется:

  • Высокой прочности — «А»;
  • Обычной прочности — «В».

Стальной гнутый швеллер подразделяется на:

  • Гнутый равнополочный швеллер;
  • Гнутый неравнополочный швеллер.

Стальные гнутые равнополочные швеллера согласно ГОСТу 8278-93 изготавливаются на трубных станах из рулонной стали обыкновенного качества и углеродистой качественной конструкционной стали. Высота равнополочного составляет от 50 до 400 мм, ширина от 32 до 115 мм.

Стальные гнутые неравнополочные швеллера изготавливаются на профилегибочных станах из рулонной холоднокатаной и горячекатаной стали обыкновенного качества, углеродистой качественной конструкционной и низколегированной стали по ГОСТу 8281-80. Они также подразделяются по номерам, которые обозначают расстояние между полками (в мм). Разновидности длины такие же, как и у равнополочных швеллеров.

Высшей категории качества гнутого неравнополочного и равнополочного швеллера соответствуют категории А и Б.

В зависимости от точности прокатки гнутые швеллеры подразделяются:

  • Высокой точности — «А»;
  • Повышенной точности — «Б»;
  • Обычной точности — «В».
Гнутый равнополочный швеллерГнутый неравнополочный швеллер

Формы гнутого швеллера:

  • «У» — швеллер с уклоном внутренних граней полок;
  • «П» — швеллер с параллельными гранями полок;
  • «Л» — швеллер легкой серии с параллельными гранями полок;
  • «С» — швеллер специальный.

В связи с широтой ассортимента швеллера на него было разработано много ГОСТов и технических регламентов. Соответствие швеллера этим ГОСТам, является залогом качества продукции.

Применение швеллера стального

Благодаря своей высокой осевой прочности на изгиб, относительно невысокой массе и металлоемкости, швеллер горячекатаный и швеллер гнутый находят широкое применение практически во всех отраслях экономики.

Кроме специальных швеллеров, используемых в автомобильной и вагоностроительной промышленностях, в качестве рам, каркасов и прочих несущих конструкций, это основной материал, используемый в строительстве.

Швеллер используется как для армирования железобетонных конструкций, так и в качестве самостоятельного материала для изготовления каркасов строений, перекрытий, пандусов.

Швеллер применяется при строительстве перекрытий больших пролетов и многоэтажных каркасных сооружений. Зачастую он используется в качестве арматуры для стен, кровли, а так же для усиления бетона. Швеллер прекрасно выдерживает нагрузки как осевые, так и несущие.

Прайс-лист — швеллер

Компания «МИНПРОМ ГРУПП», предлагает широкий ассортимент стального швеллера по приемлемым ценам, с которыми можно ознакомиться в прайс-листе.

Наши менеджеры, помогут рассчитать стоимость катанки, также проинформируют о скидках, действующих сейчас в нашей компании на необходимый тоннаж и вид швеллера — звоните. Компания «МИНПРОМ ГРУПП» придерживается доступной ценовой политики, поэтому стоимость швеллера достаточно низкая.

Посетители которые хотят купить швеллер, часто ищут его так: швелер, швеллєр, швеллер горячекатанный, швелер гнутый, швелер гнутий, швеллер гнутый, швеллер гнутий, швелер стальной, швелер стальний, швелер сталевий.

Чем различаются швеллеры У и П

Строительство гаража, бытовки или высотного здания не может обойтись без несущих элементов. Самый известный из них – швеллер. Форм-фактор определяется ГОСТом, выделяются разновидности типа П и типа У. В чем различие этих профилей?

 

Что такое швеллер

 

Считается, что конструкционную балку изобрели в Германии. Во всяком случае, в России принято называть П-образный профиль немецким словом швеллер. Элементы выпускаются различных размеров, определяемых расстоянием между ножками буквы П (полками).

 

Где используется швеллер

 

Везде, где нужна жесткая опора или прочный каркас. Пандус для колясок, каркас строительного домика, гараж, быстровозводимые ангары – все сделано из швеллеров. В промышленности П-профиль кладут под фундаменты станков, на них же монтируют кран-балки.

 

Инженеров привлекает отличное сочетание прочности в любых направлениях нагрузки (кручение, изгибы) с малым весом. Кроме того, прямые поверхности стыкуются, как детский конструктор, можно собирать дома любых форм.

 

Сортамент швеллеров

 

Стандартизация – основа прогресса. На швеллеры существуют ГОСты, задающие особенности профиля и расстояние между полками. Проектируя небоскреб или мост, инженер может выбрать требуемый сортамент по прочности.

 

Согласно стандарту, швеллер обозначается цифрой и буквой. Цифра показывает расстояние между полками в сантиметрах. Несмотря на то, что профиль швеллера всегда П-образный, у него могут быть особенности, уточняемые буквой:

  • П – швеллер с параллельными полками и прямым углом;
  • У – швеллер с наклонными внутренними стенками;
  • Э – экономичный;
  • Л – облегченный.

 

На рисунке 1 один изображены профили поперечного сечения швеллеров различных серий.

 

 

Для постройки гаража достаточно будет 5П, для перекрытий подходит 10П, самый распространенный размер для каркасов зданий – 14П.

 

 

Чем отличаются швеллеры У и П

 

Для производства швеллеров обеих серий используется технология горячей прокатки. Прокатный стан металлургического завода неоднократно протягивает через валки раскаленный металл, формируя профиль. Поверхность горячекатаных швеллеров не очень гладкая, при монтаже приходится шлифовать плоскости, подгоняя элементы друг к другу.

 

Швеллеры серии П и У отличаются формой поперечного сечения. Для примера рассмотрим изделия 40П и 40У (позиция 1 и позиция 2 на рисунке 1).

 

  • У швеллера 40П внутренняя линия полки параллельна наружной, то есть, толщина полки одинакова по всему сечению.
  • У швеллера 40У внутренняя часть полок выполнена с уклоном, то есть толщина полки меняется вдоль сечения. Толщина полки с края меньше, и постепенно увеличивается к основанию. Типовое отклонение – 5-10%.

 

При этом площадь поперечного сечения швеллеров серии У и П является одинаковой, вес 1 погонного метра также является одинаковым, теоретические справочные значения, характеризующие швеллер У и П, также являются близкими значениями.

 

Решение о применении той или иной серии должен принимать конструктор, который обладает всей полнотой информации о назначении проектируемой конструкции и нагрузках, которые она будет испытывать.

Чаще всего горячекатаные швеллеры используются в крупных проектах – мостах, переходах, армирующих конструкциях. Там, где качество поверхности не имеет решающего значения, где стыковка внутренних плоскостей не требуется, зато важен запас прочности на изгиб.

 

Подводя итоги, чем отличается швеллер У от П:

  • Внутренние стенки профиля наклонены;
  • Прочность сортамента У на изгиб выше, чем такого же типа П;
  • Особенности формы ограничивают применение.

 

Во многих случаях горячекатаные швеллеры всех серий могут быть заменены аналогичными по размерам гнутыми швеллерами. Вопрос возможной замены также решает конструктор.

виды, номер, марка и размеры

Маркировка и обозначение швеллера в соответствии с ГОСТ 8240


Высота профиля швеллера примерно в 1,5-3,5 раза больше ширины. Форма его сечения обеспечивает ему высокие показатели жесткости. Это позволяет использовать данный вид проката в тяжелом машиностроении и строительстве, в основном, для изготовления ответственных металлоконструкций, в качестве несущих элементов перекрытия, каркасов зданий и сооружений. Кроме того, многие марки швеллеров применяют в автомобилестроении, вагоностроении, для изготовления опор, ограждений, ворот, в декоративных целях.


Геометрические параметры и размеры швеллеров серии П (с параллельными гранями) и серии У (с уклоном внутренних граней) совпадают, основное отличие только в радиусах закругления полок.


Ключевой параметр в маркировке и обозначении — высота. Номер швеллера = Высота в мм / 10, или, по-другому, равен высоте швеллера в см.

















Номер швеллера

Высота швеллера

Ширина полки

Толщина стенки

Толщина полки

5П, 5У

50

32

4,4

7,0

6,5П, 6,5У

65

36

4,4

7,2

8П, 8У

80

40

4,5

7,4

10П, 10У

100

46

4,5

7,6

12П, 12У

120

52

4,8

7,8

14П, 14У

140

58

4,9

8,1

16П, 16У

160

64

5,0

8,4

18П, 18У

180

70

5,1

8,7

20П, 20У

200

76

5,2

9,0

22П, 22У

220

82

5,4

9,5

24П, 24У

240

90

5,6

10,0

27П, 27У

270

95

6,0

10,5

30П, 30У

300

100

6,5

11,0

40П, 40У

400

115

8,0

13,5

Виды швеллеров – классификация, стандарты


По способу производства швеллер подразделяется на гнутый и горячекатаный профиль. Гнутый профиль получается методом холодного профилирования из стальной листовой заготовки (штрипса). В свою очередь гнутый швеллер может быть равнополочным и неравнополочным.


ГОСТ 8278-83 регламентирует сортамент и предельные отклонения гнутого стального равнополочного швеллера. По требованиям данного документа размеры швеллера могут находиться в интервале от 25х26 до 410х65 толщиной от 2 до 20 мм. Длина гнутого профиля, который изготавливается из углеродистых, низколегированных сталей, может иметь значение от 3 до 12 м.


ГОСТ 8281-80 содержит сортамент и величину предельных отклонений гнутого стального неравнополочного швеллера, который изготавливается из марок обыкновенного качества и качественных углеродистых сталей, а также низколегированных марок. Размеры профиля согласно данному документу лежат в диапазоне от 32х22х12 до 300х80х40, толщиной от 2 до 10 мм. Мерная длина данного профиля имеет значение 4-11,8 метров.


ГОСТ 8240-97 содержит сортамент, классификацию и предельные отклонения размеров горячекатаного швеллера общего и специального назначения. Профиль данной групп может быть высотой 50 — 400 мм. Номер швеллера отражает высоту сечения, выраженную в сантиметрах. Согласно указанному стандарту поперечное сечение швеллера может иметь 2 типа профиля: 1) с уклоном граней (серии У и С), 2) с параллельными гранями (серии П, Э и Л). Ширина профиля соответствует ширине полки и может принимать значение 32-115 мм. Маркировка швеллера, например 10П, отражает его высоту и тип профиля.


Также существуют и узкоспециализированные виды швеллеров. Их форма и размеры регулируются соответствующими стандартами.


ГОСТ 21026-75 стандартизирует прокат с отогнутой полкой, которые используются для производства вагонеток. Они имеют всего 2 типоразмера СП-10 и СП-12. ГОСТ 5267.1-90 содержит размеры и справочные характеристики швеллеров горячекатаных для вагоностроения. Номер швеллера по требованиям данного стандарта может принимать значения от 8В до 30В-2. ГОСТ 5422-73 содержит размеры профилей горячекатаных, предназначенных для тракторов. Согласно стандарту профиль №5 – соответствует швеллеру 24Т, а профиль №6 – 18Т.

Как правильно расшифровать условное обозначение швеллера


Вид условного обозначения швеллера зависит от его типа (ГОСТ) и материала из которого он изготовлен. К примеру, швеллер 30П обычной точности прокатки В, выполненный из стали Ст3, четвертой категории, первой группы имеет следующее обозначение:

  • Швеллер 30П-В ГОСТ 8240-97/Ст3сп4-1 ГОСТ 535-88


Тот же профиль из стали 09Г2С повышенной точности прокатки, класса прочности 345 обозначается:

  • Швеллер 30П-Б ГОСТ 8240-97/345 ГОСТ 19281-89


Гнутый равнополочный швеллер размером 300х80х6 точности профилирования А (высокой), из штрипса повышенной Б точности прокатки, второй категории из стали Ст3сп обозначается:

  • Швеллер А 300х80х6 Б ГОСТ 8278-83/2-Ст3сп ГОСТ 11474-76

Отличия гнутого и горячекатаного швеллера — что выбрать?

Для возведения различного рода конструкций, машиностроения, станкостроения и в других областях часто применяют стальной швеллер, как надежный, недорогой и прочный элемент. При этом чаще всего изделие поставляется в двух видах — горячекатаный металлический и холоднокатаный гнутый.

На первый взгляд, разница между ними невелика, но специалисту нужно знать нюансы, которые не только позволят отличить два этих вида профиля на глаз, но и выбрать для ваших работ именно тот вид, который будет наиболее подходящим. Ведь и у того, и у другого есть свои преимущества и специфика.

Метод изготовления

Догадаться о методе изготовления обоих вариантов можно исходя из их названия. Горячекатаный стальной швеллер получают при помощи метода горячего проката на специальных станках. Под воздействием высокой температуры стальная заготовка становится пластичной и принимает нужную форму, то есть прокат с П-образным сечением.

Чтобы получить гнутый стальной швеллер, в качестве заготовки используется металлическая полоса нужного размера, которая сгибается на специальном оборудовании. Это может быть автоматизированная линия на большом производстве, где профилегибочный станок по нужным размерам изготовит желаемый профиль. Гораздо реже гнутые швеллеры произвольного размера изготавливают небольшими партиями на механическом неавтоматизированном оборудовании.

Отличия

Основное внешнее отличие, по которому видна разница между двумя видами П-образного профиля, это внешний уголок. У холоднокатаного варианта он более округлый, а у горячекатаного можно заметить небольшое утолщение на уголке, которое придает ему особенную прочность.

Второе важное отличие — это вес. Гнутый вариант гораздо легче г/к, поэтому его можно использовать для создания облегченных конструкций.

Третье различие — прочность. Горячекатаный вариант отличается большей прочностью, так как его место сгиба более надежно и не подвергалось механической деформации. Кроме того, прочность дополнительно можно узнать по маркировке партии, где литера В обозначает стандартную прочность, Б – повышенную, а А — самую высокую.

Наконец, последнее различие — это выбора размеров и вариантов. Горячекатаный профиль изготавливается на стандартных станках, поэтому его размеры четко ограничены стандартами. У холоднокатаного швеллера, который иначе иногда называется облегченным, гораздо больше вариантов изготовления, ведь в П-образный профиль можно согнуть полосу какого угодно размера. При этом точность готового стального изделия будет даже выше, чем у «горячего» варианта.

Выбор

Исходя из свойств и характеристик, специалисты рекомендуют делать следующий выбор. Для тех конструкций, где особенно важна прочность, устойчивость и надежность, например, для каркасов, лучше приобрести швеллер, изготовленный горячим катанием. Если же вам особенно важен вес готовой конструкции и вы хотели бы ее облегчить, а также если вам нужен прокат высокой точности или вы предполагаете использовать П-образный профиль для изготовления станков или машин, то больше подойдет гнутый металлический швеллер.

Швеллер – виды, их особенности, области применения

Швеллер – металлоизделие П-образного сечения, изготовленное способами прокатки или гибки. Швеллеры представлены меньшим ассортиментом, по сравнению с угловым прокатом. Но предлагаемого сортамента вполне достаточно для реализации большинства инженерных решений. Основная область применения швеллера – крупногабаритные стержневые конструкции колонн, прогонов крыш, мостов.

Геометрические параметры П-образного профиля

Размерные параметры швеллера определяются номером, который равен высоте (расстоянию между наружными гранями), определённой в сантиметрах. Прочие размеры установлены ГОСТом и представлены в справочных таблицах.

Внимание! Существует общее условие выбора швеллера (и других сечений балки) для конкретной инженерной задачи. Если расчётные параметры изделия уступают свойствам ближайшего стандартного варианта менее чем на 5%, то выбирают именно этот номер. Если более 5%, то предпочтение отдают следующему номеру.

П-образный профиль изготавливают двумя способами – горячей прокаткой и гибкой.

Горячекатаный стальной швеллер – основные характеристики и сферы использования

Швеллер стальной горячекатаный – фасонный прокат, способный придавать особую прочность строительным конструкциям. П-образная форма обеспечивает устойчивость изделий к осевым усилиям и боковым деформациям, поэтому такая продукция незаменима в мостостроении и других производствах, испытывающих серьёзные нагрузки.

По точности размерных параметров выделяют три группы:

  • А – высокой;
  • Б – повышенной;
  • В – обычной.

Изделия категорий Б и В относятся к продукции высшей категории качества.

Горячекатаный швеллер изготавливают с полками, внутренние поверхности которых находятся параллельно друг к другу или с уклоном. Помимо обычных изделий с параллельными внутренними гранями, выпускают изделия лёгкой и экономичной серий.

Внимание! Для изготовления конструкций, предназначенных для работы под большими нагрузками, используют швеллеры с наклонными внутренними гранями. Уклон поверхностей может составлять 4-10%.

Специальный швеллер выпускают для автомобилестроения и производства вагонов. Такие изделия разделяют на два класса: А – высокой прочности и В – обычной. Класс прочности определяется точностью прокатки.

Высота горячекатаного швеллера обычного и специального назначения колеблется в пределах 50-400 мм, ширина полки – 32-115 мм, длина изделия – 4-12 м. По требованию заказчика могут поставляться отрезки длиной более 12 м.

Гнутый швеллер – заготовки для производства и основные свойства

Этот вид П-образного профиля изготавливается из листовой горяче- или холоднокатаной стали обыкновенного качества, качественной конструкционной, низколегированной стали. Оборудование – профилегибочные станки. Размеры гнутого швеллера определяются так же, как и горячекатаного, – номерами. Разновидности продукции – равнополочная и неравнополочная.

Отличия гнутого швеллера от горячекатаного:

  • Визуальная характеристика – скругление наружных углов.
  • Преимуществом гнутых изделий является исправление дефектов заготовки при обработке на профилегибочных станках. Это исключает потребность в последующей обработке продукции, например, снятии фасок.
  • Гнутый швеллер – более дешёвый и меньший по весу вариант, по сравнению с горячекатаными изделиями.

Сферы использования гнутого швеллера

Прочностные характеристики П-образных изделий, полученных способом гибки, уступают аналогичным параметрам горячекатаной продукции. Поэтому гнутый швеллер не применяют при устройстве несущих элементов, планируемых для эксплуатации в условиях серьёзных нагрузок.

В каких ситуациях применяют гнутый швеллер:

  • В стальных каркасах в роли дополнительных усиливающих деталей.
  • В мероприятиях по реконструкции объектов жилого и промышленного использования. Такие изделия позволяют снизить нагрузку на фундамент.
  • В отделочных работах. Например, для создания перегородок в жилых строениях, офисах, производственных помещениях.
  • В производстве рамных конструкций в автомобиле- и вагоностроении. Наиболее часто – для изготовления несущих рам грузовых автомобилей, строительной и дорожной техники.

Тип швеллера и его номер определяют только по результатам расчётов, произведенных специалистом. Неправильный выбор размерных и прочностных характеристик может стать причиной снижения надёжности конструкции.

Сравнение швеллера, уголка и балки


Металлические углы, швеллеры, балки – каждый из продуктов металлопроката находит применение в строительной сфере. Выбор происходит на основании определенной задачи строительства. Двутавровая балка представляет собой профиль, она жесткая, прочная. Размерный ряд предполагает отличие по ширине, толщине, наименованию применяемой стали.


Швеллеры в отличие от балок применяются в вагоностроении, станкостроении, машиностроении, а также постройки зданий, сооружений. Этот универсальный элемент является частью каркаса крыше, участвует в создании вагона машинного состава. Стальной угол – участник большого количества строений различной направленности.


Отличия: форма, размеры, технологические особенности


Часто возникающую путаницу между тремя моделями профилей легко вычислить по внешнему виду. Все виды швеллерных балок имеют п-образное, дугообразное сечение. Сечение уголка имеет форму буквы «L». Швеллер двутавр имеет сечение буквой «Н». Из-за нерентабельности был прекращен выпуск Т-образных двутавров, но данный вид металлопрофилей пока еще пользуется спросом среди клиентов. Полную замену им составляют профили сечением «Н».


Швеллерная продукция п-образной формы характерна для горячекатаного изделия. Дугообразный формат имеют гнутые профили. Наиболее удобным для решения различных задач строительства считается классический швеллер в форме буквы «П». Двутавровая модель гораздо жестче, прочнее вышеописанного типоразмера. Части перекрытия здания на нее укладывать легче.


  


В качестве несущей составляющей дома двутавр прочнее, если его поставили вертикально. Если говорить о боковых нагрузках, перпендикулярных по вертикали, то тут выигрывает швеллер. Все дело в том, что происходит смещения центра тяжести сортамента в сторону поперечных сторон полок. Двутавр действует вертикально, на обе полки, стенка в этот момент противодействует сжатию.


Оба способа производства стальных углов — изгиб, горячий прокат, обеспечивают профиля устойчивостью к различным типам нагрузок. При высокой прочности они имеют приемлемую вязкость, долгое время противостоят износу. Швеллер, уголок, балка – каждый из типов металлопроката находит обширное применение в разных сферах строительства.


Где применяются швеллер, двутавровая балка, стальной уголок?

Стальной угол находит применение:

  • производство техники больших размеров, автомобилестроение, строительство вагонов;


  • производство мебели;


  • формирование идеально точных, ровных углов при создании дверных, оконных проемов;


  • оформление коммуникаций, проведение кабелей, труб, пр.;


  • усиление бетонных стен, в качестве арматурного крепления.

Двутавровая балка незаменима:

  • строительство типовых зданий;


  • воплощение сложных архитектурных проектов;


  • сооружение ответственных металлоконструкций: мостов, подземных, наземных переходов;


  • как направляющая для промышленных систем кранов.

Швеллерная продукция применяется:

  • в создании металлоконструкций;


  • как перекрытие многоэтажных строений;


  • в автомобильной промышленности, вагоностроении, станкостроении;


  • в создании деталей для техники.


Каждая металлическая деталь имеет собственную специализацию. Швеллер подходит для использования в облегченных строениях, механизмах. Двутавр способен стать частью ответственной, сложной конструкции, целого здания. Стальной угол – как часть металлоконструкции или как деталь, придающая эстетику конструкции.


Почему удобно покупать металлопрокат в «Сталь-Инвест»?


На базах компании «Сталь-Инвест» всегда имеются большие партии металлопродукции, готовой к отгрузке заказчикам со всей России. Позвонив по многоканальному телефону, указанному на сайте, вы узнаете точные расценку на метр, тонну стального фасонного проката, узнаете у специалистов отличия каждой модели из ассортимента.

субъединиц β влияют на биофизические и фармакологические различия между кальциевыми токами P- и Q-типа, экспрессируемыми в клеточной линии млекопитающих

Abstract

Клетки эпителия почек человека (HEK) были приготовлены для совместной экспрессии α1A, α2δ с различными субъединицами β кальциевых каналов и белком зеленой флуоресценции. Для сравнения кальциевых токов, наблюдаемых в этих клетках, с собственными нейронными токами, одновременно использовались электрофизиологические и фармакологические инструменты. Записи тока целых клеток эпителиальных клеток почек человека, трансфицированных α1A, показали небольшие токи инактивации в 80 мМ Ba 2+ , которые были относительно нечувствительны к блокаторам кальция.Коэкспрессия α1A, βIb и α2δ вызвала устойчивый инактивирующий ток, обнаруженный в 10 мМ Ba 2+ , обратимо блокируемый низкой концентрацией ω-агатоксина IVA (ω-Aga IVA) или синтетического токсина воронко-паутины (sFTX). Бариевые токи также поддерживались субъединицами α1A, β2a, α2δ, которые демонстрировали самую медленную инактивацию и были относительно нечувствительны к ω-Aga IVA и sFTX. Совместная экспрессия β3 с той же комбинацией, что и выше, вызвала инактивирующие токи, также нечувствительные к низкой концентрации ω-Aga IVA и sFTX.Эти данные показывают, что комбинация α1A, βIb, α2δ лучше всего напоминает каналы P-типа, учитывая скорость инактивации и высокую чувствительность к ω-Aga IVA и sFTX. Что еще более важно, специфичность блокатора каналов сильно зависит от субъединицы β, связанной с субъединицей α1A.

После первоначального описания кальциевых каналов P-типа в клетках Пуркинье (1, 2) и последующего обозначения кальциевых каналов Q-типа как отдельной категории каналов (3) возникла озабоченность по поводу их истинной отличимости.Рассматриваемый вопрос касается использования фармакологических или биофизических операционных определений в качестве единственного требования при характеристике каналов, особенно с учетом функционального значения этих компонентов в физиологии и патологии центральной нервной системы. Действительно, молекулярные элементы для нативных каналов P- и Q-типа остаются невыясненными (4, 5).

В настоящее время принятая номенклатура потенциалзависимых кальциевых каналов включает L, N, P, Q, R и T. Эти каналы представляют собой мультимерные структуры, состоящие из основной порообразующей субъединицы (α1), которая может обеспечивать проводимость ионов кальция на свой собственный в гетерологичных системах экспрессии (5, 6).Кроме того, две другие субъединицы важны для функционирования канала, α2δ и β (7, 8). Было показано, что субъединица α2δ увеличивает количество субъединицы α1C (кальциевый канал L-типа) в плазмалемме, тогда как субъединица β увеличивают вероятность открытия кальциевых каналов, экспрессируемых субъединицей α1C (9). В случае каналов P- и Q-типа на основании фармакологии (5, 10), экспериментов по молекулярной диссекции (11) и субклеточной локализации (12, 13) было предложено, что субъединица α1A является порообразующей. компонент.Учитывая, что эта субъединица не воспроизводит функциональные свойства кальциевых токов P и Q сама по себе, мы проверили, вызывают ли различные субъединицы β в присутствии постоянной субъединицы α2δ какие-либо различия в электрофизиологических и / или фармакологических свойствах токов α1A в система экспрессии млекопитающих.

МАТЕРИАЛЫ И МЕТОДЫ

Получение клеток эпителиальной почки человека (НЕК), экспрессирующих белки канала.

Для временной экспрессии канальных белков клетки HEK 293T выращивали в среде DMEM (GIBCO) с добавлением 10% фетальной бычьей сыворотки, 100 единиц / мл пенициллина G и 100 мкг / мл стрептомицина (GIBCO) и высевали на чашки с концентрацией 50%. слияние.Соответствующие кДНК (α1A, α2δ, βIb, β2a, β3 и белок зеленой флуоресценции) были субклонированы в вектор экспрессии млекопитающих pcDNA 3.1 (Invitrogen). Все субъединицы кальциевых каналов были любезным подарком Т. Снатча (Университет Британской Колумбии, Ванкувер). Белок зеленой флуоресценции был получен от CLONTECH. Клетки, экспрессирующие каналы, получали с использованием DOTAP (Boehringer Mannheim) для введения рекомбинантных векторов (1 мкг каждого) липофекцией в соответствии с протоколами производителя. После трансфекции клеткам позволяли достичь 70% слияния, затем высевали в соотношении 1: 5 и регистрировали через 8-24 часа.

Электрофизиологический анализ.

записи целых клеток (14) получали из зеленых флуоресцентных клеток, которые наблюдали при длине волны возбуждения 488 нМ и испускании 515 нМ при комнатной температуре с помощью Axopatch 200-A (Axon Instruments, Foster City, CA). Клетки поддерживали во внеклеточном растворе, содержащем 135 мМ NaCl, 3,5 мМ KCl, 1,5 мМ CaCl 2 , 1,0 мМ MgCl 2 , 5,0 мМ глюкозы и 10 мМ Hepes (pH доведен до 7.35 с NaOH). Для регистрации токов бария внешний раствор содержал 142 мМ тетраэтиламмония (TEA) -Cl, 10 мМ BaCl 2 и 10 мМ Hepes⋅CsOH (pH 7,35) «стандартный раствор». В экспериментах с высоким содержанием внеклеточного бария использовали 80 мМ BaCl 2 , 12 мМ TEA-Cl, 10 мМ Hepes (TEA), 290 мОсм с сахарозой, и потенциал жидкого соединения измеряли и вычитали для создания графиков I – V (15 ). Пипетки с патч-зажимом содержали раствор 110 мМ CsMeSO 4 ,4.5 мМ MgCl 2 , 10 мМ EGTA, 8 мМ АТФ и 10 мМ Hepes (pH доведен до 7,35 с помощью CsOH) и показали сопротивление 3–7 МОм (обычно 4 МОм). Кальциевые токи получали во внеклеточном растворе 40 мМ CaCl 2 , 80 мМ TEA-Cl, 10 мМ Hepes⋅CsOH (pH 7,35), 290 мОсм. Для этих экспериментов раствор для пипетки содержал 2,0 мМ EGTA, в остальном идентичный описанному. Сопротивление уплотнения обычно составляло 10 ГОм. Записи были получены с частичной компенсацией последовательного сопротивления (60–80%), при этом большая часть емкости ячейки погашена.Токи подвергались фильтрации нижних частот на частоте 2–5 кГц с использованием восьмиполюсного фильтра Бесселя (Frequency Devices, Хаверхилл, Массачусетс) и оцифровывались на частоте 2,5–5 кГц. Вычитание утечки и остаточной емкости было получено с использованием протокола P / 4. Для сбора и анализа данных и протоколов фиксации напряжения мы использовали программное обеспечение pclamp (Axon Instruments). Лекарства, а также регистрирующие внеклеточные растворы вносились местно с помощью тупой пипетки (гравитационный поток). sFTX (1, ​​16, 17) был свежеприготовлен перед использованием, а ω-Aga IVA (подарок от Pfizer) хранился при -20 ° C в виде исходного раствора (100 мкМ).

РЕЗУЛЬТАТЫ

Фармакологический профиль тока, экспрессируемого субъединицей α1A, варьируется в зависимости от связанной с ней субъединицы β.

Эффекты sFTX и ω-Aga IVA на экспрессируемые токи кальция были исследованы на клетках HEK 293T, временно трансфицированных кДНК α1A, α2δ с кДНК различных β-субъединиц и без них. Белок зеленой флуоресценции использовали для идентификации трансфицированных клеток. Выражение различных комбинаций привело к токам Ba 2+ с характерными электрофизиологическими свойствами (рис.1) в цельноклеточном режиме (см. Также ссылку 5). Когда субъединицы α1A коэкспрессируются с α2δ и βIb, они продуцируют быстро активирующийся внутренний ток Ba 2+ , чувствительный к субмиллимолярным концентрациям sFTX. Кривая доза-ответ (рис. 2 A ) показывает IC 50 410 мкМ с максимальным блоком насыщения около 1,5 мМ. Интересно, что более высокая внеклеточная концентрация Ba 2+ (80 мМ, концентрация, обычно используемая в одноканальных исследованиях) сдвинула кривую зависимости реакции от дозы sFTX (рис.3 C и D ). Эти результаты согласуются с исследованиями, в которых сообщается о зависимости концентрации ионов Ba 2+ от sFTX-блока P-подобных кальциевых токов, экспрессируемых в ооцитах Xenopus (16).

Рисунок 1

Общие свойства субъединицы кальциевого канала α1A, экспрессируемой сама по себе и в комбинации с различными субъединицами β в клетках HEK (293T). Вольтамперные отношения для α1A, α2δ, βIb (▪), α1A, α2δ, β2a (▴) и α1A, α2δ, β3 (•). Токи регистрировали в «стандартном» внеклеточном растворе.( A ) Наблюдали макроскопические токи бария в цельной клетке временно трансфицированных клеток HEK, экспрессирующих различные комбинации субъединиц кальциевых каналов. Токи бария, возникающие в ответ на шаги деполяризации от удерживающего потенциала -90 мВ. α1A на этапе 80 мМ внеклеточного бария до +20 мВ ( B ), α1A, α2δ, βIb на этапе «стандартного раствора» до +10 мВ ( C ), α1A, α2δ, β2a ( D ) и α1A, α2δ, β3 ( E ) в ответ на тот же протокол, что и в C .Токи хвостов α1A, α2δ и двух различных субъединиц β генерировались из импульса до + 10 мВ, а затем переходили к -110 мВ с шагом 10 мВ каждые 20 секунд; показаны записи хвостов, сгенерированных при -80 мВ для α1A. , α2δ, β2a (три усредненных тока) ( F ) и α1A, α2δ, βIb ( G ).

фигура 2
Эффект

sFTX на токи α1A, α2δ варьируется в зависимости от коэкспрессируемой субъединицы β. Доза-реакция для токов α1A, α2δ, βIb (•), токов α1A, α2δ, β2a (▴) и токов α1A, α2δ, β3 () при отмеченных концентрациях sFTX, локально применяемых с помощью пипетки с тупым концом.Обратите внимание на разницу в чувствительности между токами, производимыми в клетках, экспрессирующих βIb, и две другие комбинации субъединиц ( A ). α1A, α2δ, βIb ток целых клеток с использованием того же протокола, что и на фиг. 1 C , до (контроль) и после 1 мМ sFTX (sFTX 1 мМ) ( B ). Эффект sFTX наблюдался в течение ~ 1 мин, был обратимым и вызывал заметную разницу в τ инактивации (см. Текст).

Рисунок 3

sFTX, но не ω-Aga IVA. На блок токов α1A, α2δ, βIb воздействуют ионы бария. I – V отношения α1A, α2δ, βIb до (контроль O) и после ω-Aga IVA () в 80 ( A ) и 10 мМ барии ( B ), также показан тот же тип I. Отношения –V до и после 1 мМ sFTX () в 80 ( C ) и 10 мМ барии ( D ). Все записи были выполнены с использованием того же протокола, что и на рис. 1 C . Шаги напряжения от -50 до + 40 мВ с шагом 10 мВ подавались каждые 20 секунд. Записи, выполненные в высоком барии, смещены на 10–20 мВ вправо.Это было верно для всех протестированных комбинаций субъединиц α1A, α2δ, β.

Кинетика sFTX-блока была довольно медленной, с кратковременным, но постоянным увеличением тока в секундах после местного применения ванны с последующим максимальным ингибированием через 1–4 минуты. Блок sFTX перевернулся при вымывании и имел временной ход ~ 20 секунд, достигнув 60 +/- 15% от начального тока за ~ 20 секунд. Насыщающие концентрации sFTX приводили к значительному снижению инактивации τ (инактивация τ при +20 мВ перед sFTX = 233 +/- 12 мс и 43.64 +/- 7 мсек после sFTX n = 4) (см. Рис. 2 B ), что напоминает блокаду открытого канала. Местное применение ω-Aga IVA приводило к значительному блокированию при концентрации выше 50 нМ (рис. 4 A ). Этот эффект был аналогичным при низких и высоких концентрациях внеклеточного Ba 2+ в отличие от эффекта sFTX (рис. 3 A и B ). Кинетика блока ω-Aga IVA (медленное начало его действия) была сопоставима с таковой, наблюдаемой в нейронах гиппокампа, ганглия задних корешков и гранул мозжечка (18).Текущее подавление, вызванное ω-Aga IVA, было частично обратимым при выводе токсина через 5–15 мин. Процент восстановления сильно варьировал между ячейками и составлял от 10% до 35%. Скорость и количество восстановления были изменены с помощью шагов деполяризации с высокой амплитудой (+150 мВ) (1 Гц из 30 импульсов длительностью 50 мс). Согласно этому протоколу токи α1A, βIb, α2δ восстанавливались за 3–5 минут до 40–55% от их начального значения (рис. 4 C ). Было показано, что этот протокол ускоряет восстановление после блока ω-Aga IVA как для токов P-типа в клетках Пуркинье мозжечка, так и для токов α1A, полученных при экспрессии в ооцитах Xenopus (2, 10).

Рисунок 4

ω-Aga IVA — специфический ингибитор токов α1A, α2δ, βIb. ( A ) Сравнение влияния 100 нМ ω-Aga IVA после 8 минут постоянного местного применения на α1A, α2δ, βIb (βIb), α1A, α2δ, β 2a 2a) и α1A, α2δ, β3 (β3). ( B ) Токи α1A, α2δ, β2a обратимо ингибируются 500 нМ ω-Aga IVA, вымывание (wsh) увеличивается при сильной предымпульсной деполяризации (wsh ++) (см. Текст). ( C ) Влияние ω-Aga IVA на токи α1A, α2δ, βIb до (контроль) и после применения 100 нМ Aga IVA (Aga IVA) и на протокол вывода токсинов и высокой деполяризации (wsh ++).

Коэкспрессия субъединиц α1A, β2a, α2δ была относительно нечувствительной к субмиллимолярным концентрациям sFTX, получая 40% блок при локальном применении токсина 1 мМ, с кинетикой включения и выключения, аналогичной наблюдаемой для комбинации α1A, α2δ, βIb. ω-Aga IVA в концентрации 50 нМ не оказывал значительного влияния на токи бария, производимые этой комбинацией субъединиц. Эффекты четко наблюдались только при концентрациях выше 100 нМ (рис. 4 A ).Например, 500 нМ давали 90% -ное ингибирование этого тока (рис. 4 B ). Ингибирование было обратимым в 60% клеток, достигнув 26 +/- 10% восстановления через 8-12 минут после вывода токсина, которое увеличилось до 40 +/- 15% после сильных деполяризующих предымпульсов, как показано на рис. 4 B .

Отклик на sFTX токов, полученных с помощью α1A, α2δ и β3, был аналогичен ответу на комбинацию α1A, α2δ и β2a (рис. 4 A ), с характеристиками блока, аналогичными наблюдаемым для других комбинаций субъединиц. проверено.ω-Aga IVA при 100 нМ не оказывал значительного влияния на ток. В отсутствие субъединиц β токи α1A обнаруживались только в высоком внеклеточном Ba 2+ , а местное применение sFTX приводило к блокировке только при высоких миллимолярных концентрациях (~ 30% при 5 мМ). При более низкой концентрации никаких значительных эффектов не наблюдалось. С другой стороны, 200 нМ ω-Aga IVA вызывали 30 +/- 15% ингибирования.

Вклад β-субъединиц в электрофизиологические свойства токов α1A.

Экспрессия субъединиц кальциевых каналов α1A, α2δ в гетерологичных системах экспрессии продуцировала токи бария или кальция, которые различались по амплитуде и инактивации в зависимости от того, какая субъединица β присутствует (5, 9). Мы исследовали, влияют ли субъединицы β на другие электрофизиологические свойства субъединицы α1A. Запись целых клеток клеток, трансфицированных HEK α1A, α2δ и βIb, показала, что входящие токи бария впервые наблюдались при (-20 мВ) с пиковым током от -10 до 0 мВ с быстро активирующейся кинетикой (время до пика = 2.4 +/- 0,4 мс n = 12) (Рис.1 A и C ). Потенциал, при котором была активирована половина каналов, был рассчитан по плавной кривой, подогнанной к необработанным данным I – V ( I = G ( xE ) / {1 + exp [( V V 1/2 ) / K ]} ( V 50 = 6,92 +/- 1,2 мВ и e кратное значение = 2,8). Инактивацию исследовали с помощью одиночных длинных импульсов следа, а также мгновенными начальными токами, как показано на рис.5 C и D . Инактивация наилучшим образом соответствовала одной экспоненте в обоих протоколах, что дало аналогичные результаты, хотя скорость инактивации была довольно разной для разных клеток (τ в действии до + 20 мВ = 225 +/- 64 мс n = 12) (Рис. . 5 C и D ). Бариевые токи α1A, α2δ, βIb были относительно стабильными, и в некоторых случаях не наблюдалось замедления (сокращение 20 +/- 14% n = 12). Восстановление после инактивации продемонстрировало быстрое частичное восстановление, которое мало изменилось в течение нескольких секунд, достигнув 68 +/- 8% от начального значения за 8 секунд (рис.5 В ).

Рисунок 5

Характерные особенности токов α1A, α2δ, βIb. ( A ) Сравнение I – V отношений токов α1A, α2δ, βIb в 10 (▵) и 80 (○) мМ барии. ( B ) Динамика восстановления после инактивации токов, экспрессируемых кДНК α1A, α2δ, βIb. Токи были получены во время пар деполяризующих импульсов до +10 мВ, разделенных интервалами с -100 мВ увеличивающейся длительности. Первый интервал составлял 40 мсек с шагом 40 мсек до 8 сек.Ток восстановления отображается как функция времени. ( C ) Токи α1A, α2δ, βIb, вызванные импульсами до +60 мВ от удерживающего потенциала -90 мВ. Длительность импульса увеличивается с шагом 2 мс и доставляется каждые 15 с до максимальной продолжительности 750 мс. Эта последовательность генерирует кривую с инактивацией τ, аналогичную кривой, наблюдаемой с одиночным импульсом до +10 мВ и продолжительностью 500 мс в той же ячейке ( D ). Свидетельство индуцированного кальцием ингибирования кальциевого тока в токах, генерируемых α1A, кДНК α2δ, βIb.( E ) Записи кальциевых токов (см. «Материалы и методы» ), вызванные деполяризацией до +10 мВ от Vh = -90 мВ, доставляемые каждые 30 секунд. Показаны токи, полученные при контроле (0), 2, 4 и 6 мин. ( F ) Тот же протокол и комбинация кДНК, что и в E , но в 10 мМ внеклеточном барии. Разница в стабильности тока между E и F разительна.

Попытки изучить токи с кальцием в качестве основного носителя заряда привели к прогрессивному спаду тока, почти полностью блокирующемуся в течение ∼6 мин (рис.5 E ). Действительно, такой ток, однажды исчезнув в присутствии кальция, быстро вернулся в среду Ba 2+ . Этот результат свидетельствует о том, что белковый комплекс каналов α1A, α2δ, βIb подвергается индуцированному кальцием ингибированию кальциевых каналов обратимым образом. Анализ хвостового тока ( n = 6) продемонстрировал скорость отклонения τ до -80 мВ = 0,57 +/- 0,07 мсек, что лучше всего соответствует одной экспоненте (рис. 1 G ). α1A, α2δ, β2a дали быстро активирующийся I Ba (время до пика = 2.26 +/- 0,6 мс) (Рис.1 D ). Этот ток также показал высокую изменчивость скорости инактивации; например, 50% ячеек ( n = 14) не деактивировались в течение 500 мс, тогда как у остальных ячеек τ неактивно при +20 мВ = 860 +/- 300 мс, с пиковым током от 0 до +10 мВ (рис.1 A и D ). Ток хвоста до -80 мВ лучше всего подходит моноэкспоненциально (скорость отклонения τ при -80 мВ = 0,42 +/- 0,14 мс) (рис. 1 F ).

Коэкспрессия одних и тех же субъединиц α с субъединицей β3 вызывает быструю активацию (время до пика = 2.16 +/- 0,7 мс) токи, инактивированные с помощью τ, до + 20 мВ = 214 +/- 28 мс ( n = 4) (рис. 1 A и E ). В трех изученных комбинациях, α1A, α2δ и различных субъединицах β (s) кальциевых каналов, высокий уровень внеклеточного Ba 2+ (40–80 мМ) вызывал сдвиг вправо отношения I – V (см. Рис.3 A и C и 5 A ).

ОБСУЖДЕНИЕ

Настоящий набор результатов касается вопроса о различиях между каналами P и Q.Вопрос о том, что определяет тип канала, становится одним из вопросов, требующих изучения. Наши результаты предполагают, что каналы P и Q действительно являются функциональными вариациями субъединицы α1A, причем эта вариация определяется ассоциированными субъединицами β. Этот вывод основан на биофизических и фармакологических измерениях макроскопических α1A, α2δ поддерживаемых токов бария, когда они связаны с различными β-субъединицами. Действительно, как ω-Aga IVA, так и sFTX предпочтительно блокируют комбинацию α1A, βIb с идентификатором 50 , меньшим, чем α1A, β2a и β3, которые в остальном имеют аналогичные отношения тока / напряжения.Мы пришли к выводу, что ток, связанный с βIb, наиболее близок к току нативного типа P / Q и фармакологии. Однако относительно медленная инактивация отличает его от быстро инактивируемого Q-тока, что делает α1A, βIb, α2δ наиболее вероятным кандидатом на P-ток.

В то время как биофизические результаты согласуются с предыдущими открытиями (5, 9, 10), фармакологические результаты являются неожиданными, поскольку они демонстрируют, что субъединицы β влияют на фармакологические свойства тока.Поскольку субъединица β является внутриклеточной составляющей, результаты показывают, что эта субъединица должна вызывать аллостерические изменения на субъединице α1A, которые изменяют ее фармакологическую чувствительность. Этот вывод касается вопросов характеристики канала. Из представленных результатов очевидно, что ассоциация структуры α1A, α2δ, βIb имитирует биофизические и фармакологические свойства классического P и, в меньшей степени, Q-каналов. Кроме того, он был идентифицирован как кальциевый канал P-типа гранулярных нейронов мозжечка (19) с функциональными свойствами, отличными от первоначально описанного кальциевого канала P-типа в клетках Пуркинье.Вариант P-канала для гранулярных клеток демонстрирует медленную кинетику инактивации, достигающую 34% инактивации при +10 мВ через 720 мс. Экспрессия α1A, α2δ, βIb в клетках COS (20) поддерживает более медленную инактивацию I Ba I – V , сдвинутую вправо, а также более низкую кажущуюся K D (11 нМ) для ω -Aga IVA, чем та, что описана в настоящей работе. Тем не менее, результат подтверждает мнение о том, что комбинация α1A, α2δ, βIb лучше всего воспроизводит свойства нативного канала P-типа.Что касается характеристики каналов, различия в фармакологии и электрофизиологических свойствах α1A, βIb I Ba в различных гетерологичных системах экспрессии (ооциты) (4, 5), клетках COS (20) и клетках HEK (настоящая работа) могут отражать другой механизм клеточной обработки. С другой стороны, они могут быть связаны с посттрансляционными модификациями и / или различиями в ионной силе, используемой в различных препаратах, поскольку экспрессия тех же субъединиц α с β3 в клетках HEK (21) продуцировала I – V , аналогичную один найден в этой работе.

Поскольку подавление, производимое ω-Aga IVA и sFTX на токи α1A, α2δ, β (s), достигло уровня насыщения без полного блокирования, и классификация кальциевых потоков R-типа основана на разблокированных общих кальциевых токах с токсинным коктейлем, это открытие открывает возможность того, что ток R-типа может представлять одну из протестированных комбинаций α1A, α2δ, β (s). Эта тема требует дальнейших экспериментов.

В заключение, каналы, состоящие из α1A, α2δ, β-Ib, являются наиболее вероятным молекулярным аналогом каналов нативного P-типа (ов).С другой стороны, эта структура не воспроизводит точно фармакологические свойства ни P-, ни Q-канала, так как чувствительность к sFTX и ω-Aga IVA для каналов P-типа ниже, чем для каналов α1A, α2δ, βIb в клетках HEK. , тогда как в клетках COS (20) ВАХ сдвинута вправо. Это открытие указывает на то, что в ячейках HEK могут отсутствовать другие элементы, что препятствует точному воспроизведению свойств собственных каналов.

Благодарности

Эта работа была поддержана грантами NS13742 Национального института здравоохранения Р.L. и NS30989 на B.R.

СОКРАЩЕНИЯ

НЕК,
эпителиальных клеток почек человека;
sFTX,
синтетический токсин воронко-паутинного паука;
ω-Aga IVA,
ω-агатоксин IVA
  • Принято 22 октября 1997 г.
  • Copyright © 1997, Национальная академия наук США

Каркасы Ahnak p11 / Anxa2 и L -типа потенциалзависимый кальциевый канал и модулирует депрессивное поведение

Животные

Все процедуры биохимических и поведенческих экспериментов с участием животных были одобрены Комитетом по уходу и использованию животных Института Рокфеллера и соответствовали руководящим принципам Национального института здравоохранения.Мыши p11 KO были созданы ранее [3]. Мыши Ahnak KO [31] были получены из Биоресурсного центра RIKEN. Мыши p11-EGFP (HC85) были получены от GENSAT (www.gensat.org). Флоксированных мышей Ahnak получали в Taconic-Artemis (Германия) и содержали в Университете Рокфеллера. Линии EMX-Cre (запас 005628) и PV-Cre (запас 008069) были получены из лаборатории Джексона (Бар-Харбор, штат Мэн, США). Мы произвели потомство линий Ahnak KO с помощью экстракорпорального оплодотворения (ЭКО) и методов переноса эмбрионов (центр трансгенных исследований, Университет Рокфеллера), чтобы обеспечить достаточное количество животных того же возраста для поведенческих тестов.Все мыши имеют фон C57BL / 6. Для поведенческих тестов использовали самцов мышей в возрасте шестнадцати недель. Самцов мышей в возрасте 6-8 недель использовали для регистрации целых клеток с помощью патч-кламп. Беременные самки мышей (E17) использовали для первичных культур корковых нейронов. Мышей содержали по 2–5 в клетке с 12: 12-часовым циклом свет / темнота и ad libitum доступом к пище и воде. Мышей распределили в экспериментальные группы на основании их генотипа. Отбор образцов животных из разных экспериментальных групп для электрофизиологических и биохимических анализов проводился случайным образом слепым способом.

Pulldown assay

GST Pulldown анализ выполняли, как описано ранее [9]. Передний мозг крысы гомогенизировали с помощью буфера для гомогенизации (50 мМ Tris-HCl, pH 7,5, 150 мМ NaCl и 2 мМ MgCl 2 с добавлением 1% Triton X-100 и коктейля ингибиторов протеаз (cOmplete, Sigma-Aldrich). растворимую фракцию инкубировали с гибридом GST, GST-p11 или GST-p11 / Anxa2, иммобилизованным на глутатион-агарозных гранулах (GE healthcare). После отмывания несвязанных белков связанные белки подвергали SDS-PAGE с использованием 4-20% Tris -Глициновый гель (Thermo Fisher Scientific, Гранд-Айленд, Нью-Йорк, США).После окрашивания белка кумасси бриллиантовым синим R-250 идентичность полосы белка, специально выделенной совместно с гибридом p11 / Anxa2, определяли с помощью масс-спектрометрии (Yale / NIDA Neuroproteomics Center, New Haven, CT, USA).

Плазмидные конструкции

Плазмиды, экспрессирующие HA-Ca v 1.2 (sHA-Ca v 1.2) [32], HA-Ca v 1.3 (sHA-Ca v 1.3a) [33] или Субъединица β 4b (pβA-β 4b -V5) [34] сообщалось ранее.КДНК N-концевой области (аминокислоты 2–498) и повторяющиеся элементы в центральной области человеческого Ahnak (аминокислоты 1068–1579) были получены из Pet28a-AHNAK-N-HIS-T7 и Pet28a-AHNAK-R. -HIS-T7, как сообщалось ранее [35], и субклонирован в сайт BamHI-XhoI вектора pAAV-CBA. КДНК С-концевой области мышиного Ahnak (аминокислоты 3921–5656) [36] клонировали в сайт BamHI-EcoRI вектора pAAV-CBA. pAAV-CBA-Ahnak-N-Strep, pAAV-CBA-Ahnak-R-Strep и pAAV-CBA-Ahnak-C-Strep были подтверждены секвенированием.

Количественная ПЦР (qPCR)

Суммарную РНК экстрагировали из ПФУ и гиппокампа с использованием набора RNeasy Mini (QIAGEN) в соответствии с протоколом производителя. Концентрацию РНК измеряли на спектрофотометре Nanodrop 1000 (Marshall Scientific, Хэмптон, Нью-Гэмпшир, США). Обратную транскрипцию выполняли с 1 мкг общей РНК с использованием набора для обратной транскрипции кДНК высокой емкости (Thermo Fisher Scientific, Уолтем, Массачусетс, США) в соответствии с протоколом производителя. КПЦР выполняли в 20 мкл реакционной смеси, содержащей 1 мкл (10-50 нг) кДНК, 10 мкл SYBR Premix EX Taq (Takara Bio, Kusatsu, префектура Сига, Япония), 0.4 мкл эталонного красителя Rox (50 ×, Takara Bio) и 200 нМ праймеров для каждого гена с использованием системы быстрой ПЦР в реальном времени 7500 (Thermo Fisher Scientific). Последовательности праймеров были следующими: p11 (вперед), 5′-TGGAAACCATGATGCTTACGTT-3 ‘; p11 (обратный), 5’-GAAGCCCACTTTGCCATCTC-3 ‘; AnxA2 (вперед), 5’-ATGTCTACTGTCCACGAAATCCT-3 ‘; AnxA2 (обратный), 5’- CGAAGTTGGTGTAGGGTTTGACT-3 ‘; GAPDH (вперед), 5’-AGGTCGGTGTGAACGGATTTG-3 ‘; GAPDH (обратный), 5’- TGTAGACCATGTAGTTGAGGTCA -3 ‘. Реакция протекала при 95 ° C в течение 30 с, затем следовали 40 циклов 95 ° C в течение 3 секунд и 60 ° C в течение 30 секунд и цикл диссоциации 95 ° C в течение 15 секунд, 60 ° C в течение 60 секунд и 95 ° C. C в течение 15 с.Все ПЦР проводили в трех повторностях, и специфичность реакции определяли анализом кривой плавления на стадии диссоциации. Сравнительная количественная оценка каждого гена-мишени была выполнена на основе порога цикла, нормализованного к GAPDH, с использованием метода ΔΔCT [37].

Иммуноблоттинг и антитела

Ткани префронтальной коры головного мозга (PFC) или гиппокампа лизировали лизисным буфером (Pierce IP Lysis Buffer, 87788, Thermo Fisher Scientific) с добавлением смеси ингибиторов протеаз и фосфатаз (78442, Thermo Fisher Scientific).Лизаты тканей гомогенизировали с помощью гомогенизатора Даунса (10 ходов) и центрифугировали при 800 × g в течение 5 мин. Уровни белка в супернатанте измеряли методом BCA. Образцы смешивали со стандартным буфером для образцов белка и подвергали SDS-PAGE с 4–20% гелями Novex Tris-Glycine (Thermo Fisher Scientific) с последующим переносом белка на нитроцеллюлозную мембрану. Иммуноблоттинг проводили по стандартному протоколу с использованием следующих антител: анти-Ahnak (M-DY pAb [38], кроличьи поликлональные, 1: 50 000 или RU2064, кроличьи поликлональные, 1: 10 000), анти-p11 (поликлональные козы, AF2377, R&D systems, 1: 1000), анти-Anxa2 (мышиный моноклональный, sc-28385, Santa Cruz, 1: 1000), анти-Gapdh (мышиный моноклональный, MAB374, Millipore Sigma, 1: 5,000), анти-Ca v 1.2 (кроличий поликлональный, AB5156, EMD Millipore, 1: 2,500), anti-Ca v 1.3 (кроличий поликлональный, Ab144 [39], 1: 1000), anti-Flag (мышиный моноклональный, M2, Sigma, 1: 1000 ), анти-V5 (мышиный моноклональный, SV5-Pk1, Abcam, 1: 1000), анти-HA (крысиный моноклональный, 3F10, Sigma, 1: 1000), субъединица анти-β 1 (мышиный моноклональный, 73–052 , NeuroMab, 1: 1000), субъединица анти-β 2a (поликлональное антитело кролика, RU2077, 1: 1000), субъединица анти-β 3 (поликлональное антитело кролика, RU2080, 1: 1000), анти-β 4 субъединица (моноклональная мышь, 75–054, NeuroMab, 1: 1000), субъединица δ1 анти-α 2 (моноклональная мышь, DCABH-8461, Creative Diagnostics, 1: 1000).Сыворотки RU2064, RU2077 и RU2080 были созданы против антигенных пептидов (KISMPDVDLHLKGPK [14, 40], CDSETQESRDSAYVEPKEDY [41] и CDRNWQRNRPWPKDSY [41] соответственно) (Cocalico Biologicals Inc, Пенсильвания, США). Антитела очищали с помощью колоночной аффинной хроматографии.

Культивирование тканей, трансфекция и иммунопреципитация

Клетки COS-7 (ATCC) поддерживали в среде DMEM (Invitrogen), содержащей 10% фетальной бычьей сыворотки (Sigma) и антибиотики (пенициллин / стрептомицин, Thermo Fisher Scientific).Временную трансфекцию плазмид проводили липофектамином 2000 (Invitrogen) в соответствии с инструкциями производителя. Для иммунопреципитации клетки (или ткань переднего мозга мыши) лизировали обработкой ультразвуком в буфере для гомогенизации (плюс добавки ингибиторов протеазы и 1% Triton X-100). После центрифугирования при 13000 × g в течение 10 минут супернатант инкубировали с антителом против Ahnak, связанными с контрольным антителом гранулами агарозы A / G (Pierce) или гранулами Strep-Tactin (IBA Lifesciences) в течение ночи при 4 ° C с постоянное вращение.После четырехкратной промывки буфером для гомогенизации, содержащим 1% Triton X-100, связанные белки элюировали в буфере для образцов SDS. Образцы подвергали SDS-PAGE с 4-20% гелями трис-глицина (Thermo Fisher Scientific) и иммуноблот-анализу, как указано.

Иммуногистохимия

Животных подвергали глубокой анестезии с использованием CO 2 и транскардиально перфузировали PBS, а затем 4% параформальдегидом (PFA) в PBS. Мозг постфиксировали в 4% PFA в течение ночи при 4 ° C, а затем подвергали криозащите с использованием 30% сахарозы в PBS в течение не менее 24 часов с последующим замораживанием и заливкой в ​​среду Tissue Tek OCT (Sakura Finetek USA Inc, Торранс, Калифорния). .Криостат использовался для сбора корональных срезов толщиной 40 мкм. Для всех окрашиваний между группами использовалась одна и та же смесь мастер-раствора из блокирующего буфера и антител. Иммуногистохимия проводилась параллельно между группами. Свободно плавающие срезы промывали PBS и затем инкубировали в блокирующем буфере (0,5% Triton X-100, 5% нормальная козья сыворотка в PBS) в течение ~ 2 часов при комнатной температуре. Затем срезы инкубировали в течение ночи (~ 16 ч) при 4 ° C в первичных антителах, разведенных в блокирующем буфере. Первичные антитела были следующими: анти-EGFP (поликлональные куриные, Abcam, 1: 200), анти-Ahnak (поликлональные кролики, RU2064, 1: 1000), анти-парвальбумин (моноклональные мыши, Swant, 1: 1000).После инкубации срезы трижды промывали PBS и инкубировали с вторичными антителами, конъюгированными с Alexa-fluor. Вторичные антитела были следующими: козьи антикроличьи Alexa Fluor 568 (Invitrogen, 1: 1000), козьи анти-куриные или антимышиные Alexa Fluor 488 (Invitrogen, 1: 1000) и NeuroTrace 435/455 Nissl (1: 400, Thermo Fisher Scientific). После вторичной инкубации срезы трижды промывали PBS и помещали на предметные стекла с жестко закрепленным Vectashield (Vector Labs) для микроскопии.Конфокальные изображения были получены на системе конфокальной визуализации Zeiss LSM 710 (Carl Zeiss Microscopy, Торнвуд, Нью-Йорк, США) с использованием воздушного объектива с числовой апертурой 20 × / 0,8 или масляной иммерсии с числовой апертурой 100 × / 1,4 (Carl Zeiss Microscopy, Торнвуд, штат Нью-Йорк). , США). При необходимости изображения (20 ×) были объединены в одно большое изображение. Последовательное сканирование было выполнено, поскольку это предотвращает артефакты из-за перекрестного возбуждения флуорофоров других лазерных линий и «просачивания» излучения флуорофора в каналы. Многоканальная конфигурация с последовательным сканированием для трех длин волн индивидуально возбуждалась лазерными линиями с длиной волны 405/488/561 нм и регистрировалась в соответствующем диапазоне длин волн 410–483 нм, 497–574 нм и 583–650 нм соответственно.Коэффициент усиления, время экспозиции и все другие связанные настройки были постоянными на протяжении каждого эксперимента. Постобработка заключалась в импорте на Фиджи, назначении цветов для каждого канала в изображении и объединении каналов для создания одного изображения. Все группы изображений обрабатывались параллельно с использованием Фиджи.

Первичная культура кортикальных нейронов и биотинилирование клеточной поверхности

Первичные кортикальные нейроны получали, как описано ранее [42], из эмбрионального мозга (эмбриональный день 16 или 17) гомозиготных мышей WT и Ahnak KO.Всего 2 × 10 6 нейронов коры помещали на чашки диаметром 35 мм, предварительно покрытые поли-L-лизином. Нейроны выращивали в нейробазальной среде с добавлением 0,5 мМ l-глутамина, B27 (2%) и N2 (1%). 5-Фтор-2-дезоксиуридин (30 мкМ, Sigma-Aldrich) добавляли для ингибирования пролиферации ненейрональных клеток.

На DIV 7 чашки для культивирования помещали на лед и дважды промывали холодным PBS + буфером (забуференный фосфатом физиологический раствор плюс 0,1 мМ CaCl 2 , 1 мМ MgCl 2 , pH 8.0). К клеткам добавляли свежий сульфо-NHS-SS-биотин (21335, 0,5 мг / мл; Thermo Fisher Fisher) в 1 мл буфера PBS +. Чашки осторожно встряхивали в холодной комнате в течение 30 минут на льду, после чего следовала 5-минутная промывка клеток три раза 100 мМ глицина в PBS + на льду и еще одна 5-минутная промывка клеток трижды PBS + на льду в холодную комнату с легким встряхиванием. После удаления промывочного буфера нейроны соскребали лизисным буфером RIPA (89901, Thermo Fisher Scientific) с добавлением ингибиторов протеаз и фосфатаз (78442, Thermo Fisher Scientific) и помещали на лед на 10 мин.После центрифугирования при 16000 × g в течение 10 минут при 4 o ° C супернатант собирали и измеряли уровень белка с помощью анализа BCA. Десять микрограммов контроля загрузки и равное количество общего белка (100 мкг) инкубировали с 20 мкл стрептавидиновых гранул (SA10004; Thermo Fisher Scientific). После инкубации с вращением при 4 o ° C в течение ночи шарики промывали буфером RIPA четыре раза, а связанные белки подвергали SDS-PAGE и иммуноблоттингу.

Пережимание цельноклеточного пластыря

Мышей в возрасте 6–8 недель умерщвляли. Мы решили использовать молодых животных для записи патч-кламп целых клеток из-за сложности записи нейронов, особенно нейронов ЛВ, из срезов 4-месячных животных. Целью этих экспериментов было исследование нейрональной функции Ахнака, а не корреляция с поведенческими экспериментами. Для экспериментов с патч-зажимом мы записывали от одной мыши WT и одной мыши KO как однопометников каждый день.После декапитации и удаления мозга поперечные срезы вырезали на Vibratome 1000 Plus (Leica Microsystems, США). Режущий раствор для префронтальной коры был (в мМ): 234 Сахароза, 2,5 KCl, 1,0 NaH 2 PO 4 , 11 Глюкоза, 4 MgSO 4 , 0,1 CaCl 2 , 15 HEPES (pH ~ 7,4, 295–305 мОсм). После нарезки срезы оставляли на 1 ч при комнатной температуре в растворе ACSF. Режущий раствор для гиппокампа был (в мМ): 105 NMDG (N-метил-D-глюкамин), 105 HCl, 2.5 KCl, 1,2 NaH 2 PO 4 , 26 NaHCO 3 , 25 Глюкоза, 10 MgSO 4 , 0,5 CaCl 2 , 5 L-аскорбиновая кислота, 3 пируват натрия, 2 тиомочевина (pH ~ 7,4 , 295–305 мОсм). После нарезки срезы оставляли для восстановления на 15 мин в том же растворе для резки при 35 ° C и на 1 час при комнатной температуре в растворе ACSF.

Регистрации целых клеток с помощью патч-клампа потенциал-зависимых токов Ca 2+ измеряли с помощью системы Multiclamp 700B / Digidata1550A (Molecular Devices, Саннивейл, Калифорния, США).Срез помещали в записывающую камеру (RC-27L, Warner Instruments, США) и постоянно перфузировали оксигенированным ACSF при 24 ° C (TC-324B, Warner Instruments, США) со скоростью 1,5–2,0 мл / мин. Клетки визуализировали с помощью вертикального микроскопа Olympus BX51WI (Olympus, Япония). Зависимый от напряжения ток Ca 2+ был выявлен с шагом деполяризации от -70 до -10 мВ. Регистрирующие пипетки (King Precision Glass, Inc, Glass type 8250) вытягивали с помощью горизонтального съемника пипеток (Narishige) до сопротивления 3–4 МОм.

Для записи тока в зависимости от напряжения Ca 2+ пирамидных нейронов слоя 2/3 в медиальных префронтальных кортикальных срезах (300 мкм) внеклеточный раствор (модифицированный ACSF) содержал (в мМ): 120 NaCl, 20 NaHCO 3 , 3,0 KCl, 1,25 NaH 2 PO 4 , 20 CsCl, 1,5 CaCl 2 , 5 MgCl 2 , 8 глюкоза, pH 7,4 и 300 мОсм (барботируется 95% O 2 и 5% CO 2 ). Добавляли тетродотоксин (1 мкМ), чтобы блокировать токи Na + .Внутренний раствор содержал (в мМ): 130 Cs-метансульфонат, 10 CsCl, 4 NaCl, 1 MgCl 2 , 5 EGTA, 10 HEPES, 5 MgATP, 0,5 Na 3 GTP, 12 фосфокреатин, 3 лидокаин, pH 7,2. –7,3 и 265–270 мОсм.

Для регистрации нейронов парвальбумина (PV) из срезов гиппокампа (400 мкм) внеклеточный раствор (ACSF) содержал (в мМ): 125 NaCl, 25 NaHCO 3 , 2,5 KCl, 1,25 NaH 2 PO 4 , 2 CaCl 2 , 1 MgCl 2 и 25 глюкозы (барботируется 95% O 2 и 5% CO 2 ).К внеклеточному раствору добавляли тетрадотоксин (1 мкМ). Внутренний раствор содержал (в мМ): 110 CsCl 2 , 30 TEA-Cl, 1 CaCl 2 , 10 EGTA, 2 MgCl 2 , 4 Na 3 ATP, 0,5 Na 3 GTP и 10 HEPES, pH 7,3. ФВ нейроны были выбраны для записи на основании их размера, формы и положения в субгранулярном слое.

Для потенциалзависимой записи Ca 2+ -тока первичных кортикальных нейронов, культуры нейронов получали из ткани мозга, выделенной из 17-дневных эмбрионов мыши.Запись цельноклеточных патч-кламп проводилась в культивируемых нейронах на DIV 11–12. Внеклеточный раствор ACSF и внутренний раствор были такими же, как те, которые использовались для регистрации нейронов PV в срезах мозга. Для регистрации были выбраны пирамидальные клетки треугольной формы. Клетки без ответа кальциевого тока были исключены из статистического анализа.

Данные были получены с частотой дискретизации 50 кГц, отфильтрованы на частоте 1 кГц и проанализированы в автономном режиме с использованием программного обеспечения pClamp10 (Molecular Devices, Саннивейл, Калифорния).Все электрофизиологические данные выражены как средние значения ± SEM. Статистический анализ проводился с использованием двустороннего непарного критерия Стьюдента t .

Поведенческие тесты

Все поведенческие тесты проводились во время светового цикла. Поведенческие анализы проводились экспериментатором, который не знал о распределении групп генотипов. Четырехмесячные наивные группы мышей WT и конститутивных мышей Ahnak KO использовали для каждого поведенческого анализа. Четырехмесячные наивные группы мышей EMX-KO или PV-KO и их контрольные мыши использовали для теста открытого поля (OFT) и депрессивно-подобных поведенческих тестов в следующем порядке: OFT (день 1), тест предпочтения сахарозы ( SPT; дни 2–4), тест принудительного плавания (FST; день 5) и тест подвешивания за хвост (TST; день 6).В наших предыдущих исследованиях с линиями p11 KO и SMARCA3 KO, поведенческие тесты, подобные депрессии, проводились в зрелом возрасте (~ 3-4 месяца) [9, 43]. Чтобы сравнить поведенческие данные линий Ahnak KO с результатами, полученными в наших предыдущих исследованиях p11 и SMARCA3, мы провели поведенческие тесты в том же возрасте. Одновременно использовались восемь открытых ящиков, четыре танка FST или четыре блока TST. Мышей из каждой группы равномерно распределяли по каждому оборудованию (например, ящикам или резервуарам) бок о бок в каждом прогоне.Распределение оборудования для экспериментальных групп было сбалансировано по запускам. FST и TST проводились, как описано ранее [3, 44]. Автоматизированное устройство TST / FST (Clever Sys Inc, Рестон, Вирджиния, США) измеряло продолжительность поведенческой неподвижности, которая оценивалась и анализировалась в течение последних 4 минут 6-минутного испытания. Для расчета общего пройденного расстояния использовалось оборудование и программное обеспечение Accuscan (Omnitech Electronics, Колумбус, Огайо). SPT проводился, как описано ранее [9] с некоторыми изменениями [43].Мышам давали выбор из двух бутылок с водой на однодневный период привыкания, а затем одну бутылку с водой заменяли бутылкой, содержащей 1,5% раствор сахарозы. Расход воды и раствора сахарозы измеряли через 24 часа. Предпочтение сахарозы рассчитывали как отношение израсходованного раствора сахарозы к израсходованной воде. Мыши, включенные в анализ данных, были здоровы на протяжении всего поведенческого тестирования. Статистические выбросы, определяемые как оценки на 2 стандартных отклонения выше или ниже среднего по группе в каждом поведенческом тесте, были исключены перед статистическим анализом данных.

Статистический анализ

Для всех количественных данных об уровнях белка или мРНК, электрофизиологии и поведенческих тестах n — это количество биологических повторов, а гистограммы представляют два или три независимых эксперимента. Для определения количества животных в группе (для биохимических, электрофизиологических и поведенческих экспериментов) расчеты основывались на накопленных эмпирических данных. Количество животных для каждого эксперимента подходило для выявления биохимических и поведенческих различий.Различия между группами оценивали с помощью непарного двустороннего параметрического теста t . Поведенческие данные прошли тест нормальности Д’Агостино-Пирсона и тест нормальности Шапиро-Уилка. Количество клеток в группе для электрофизиологических экспериментов основано на эмпирических данных, накопленных в лаборатории. Для данных патч-зажим мы использовали двусторонний параметрический тест t , которому предшествовал тест нормальности Д’Агостино-Пирсона для подтверждения нормального распределения данных. Разница между группами была аналогичной.Все данные представлены как средние значения ± стандартная ошибка среднего, и значения P менее 0,05 были определены как статистически значимые. Все анализы проводились с использованием GraphPad Prism, версия 7.04 (GraphPad Software, Сан-Диего, Калифорния, США).

ионных каналов: сигнализация различий между ресничками

Почти все эукариотические клетки имеют на своей поверхности волосовидные выступы, называемые ресничками. Реснички воспринимают сигналы окружающей среды, играют решающую роль в развитии органов и отвечают за перемещение клеток и жидкостей.Проблемы, влияющие на работу ресничек, вызывают разнообразный набор «цилиопатий», включая поликистоз почек, бесплодие, заболевания дыхательных путей и дефекты слуха (Fliegauf et al., 2007). Но чем отличаются реснички разных типов клеток?

Передача сигналов иона кальция (Ca 2+ ) является центральной для управления движением ресничек и ответом на сигналы, полученные извне клетки (Phua et al., 2015). Теперь, в eLife, Джулия Дорнер, Маркус Деллинг и Дэвид Клэпхэм из Гарвардской медицинской школы и Бостонской детской больницы демонстрируют, что ключевые принципы передачи сигналов Ca 2+ значительно различаются между разными типами ресничек (Doerner et al., 2015).

Реснички классифицируются как первичные реснички или ундулиподии на основании очевидных структурных различий (Рис. 1). Первичные реснички не способны двигаться сами по себе, но помогают клеткам обнаруживать внешние сигналы и служат центром передачи сигналов во время развития (Goetz and Anderson, 2010). Напротив, ундулиподии способны двигаться сами и подразделяются на подвижные реснички, которые перемещают жидкость по внешней поверхности клетки, и жгутики, которые продвигают клетку через жидкости (Fliegauf et al., 2007). Движение ресничек напрямую связано с аксонемой — структурой, состоящей из микротрубочек, которая служит «скелетом» и простирается по длине реснички. Все первичные реснички содержат девять пар микротрубочек, которые расположены по кругу, образуя так называемую структуру 9 + 0. У ундулиподий есть две дополнительные микротрубочки в центре аксонемы (расположение 9 + 2; Рисунок 1).

Разнообразие ресничек.

Существует два типа ресничек, первичные реснички и ундулиподии, которые отличаются различиями в строении аксонемы. Уровень ионов кальция (Ca 2+ ) внутри ресничек регулируется специализированными ионными каналами. ( A ) Основной канал Ca 2+ для первичных ресничек был идентифицирован как комплекс PKD1L1 / PKD2L1. ( B ) Существует два типа ундулиподий: подвижные реснички и жгутики.Главный канал Ca 2+ жгутиков млекопитающих был идентифицирован как белок, названный CatSper в 2013 году. Doerner et al. идентифицировали потенциал-зависимый канал L-типа Ca 2+ (семейство Ca v 1) как основной канал Ca 2+ для подвижных ресничек.

Помимо этих очевидных различий в структуре, различия в молекулярных путях, которые контролируют работу ресничек, остаются в значительной степени неизвестными. Прямое исследование молекулярного состава ресничек является сложной задачей, в основном из-за их небольшого размера, чрезвычайно низкого объема цилиарного цитозоля и тесных структурных ассоциаций между различными молекулярными компонентами.Вместе эти неблагоприятные факторы затрудняют применение всех биохимических, электрофизиологических или оптических аналитических методов.

Однако с 2001 года лаборатория Clapham играет важную роль в использовании техники patch-clamp для изучения различных цилиарных структур, начиная с открытия загадочного канально-подобного белка, расположенного в жгутике сперматозоидов (Ren et al., 2001). Этот белок, названный CatSper, структурно подобен потенциалозависимым каналам Ca 2+ , обнаруженным в нейронах.Однако в канале CatSper четыре отдельные субъединицы работают вместе, образуя функциональный канал, тогда как в нейронных каналах четыре субъединицы связаны в одну молекулу. Применение метода фиксации целых клеток к сперматозоидам показало, что CatSper слабо зависит от напряжения, что противоречит ожиданиям. Вместо этого его активность контролируется pH внутри клетки (Kirichok et al., 2006) и женским стероидным гормоном прогестероном (Lishko et al., 2011; Strunker et al., 2011).CatSper в настоящее время установлен в качестве основного и, возможно, единственного канала Ca 2+ в жгутиках сперматозоидов и, следовательно, незаменим для нормальной подвижности сперматозоидов и мужской фертильности (Рисунок 1).

В другом технологическом и концептуальном прорыве в 2013 году группа Clapham применила технику патч-кламп непосредственно к первичным ресничкам и обнаружила, что основной канал Ca 2+ этой органеллы состоит из двух субъединиц: PKD1L1 и PKD2L1 (DeCaen et al. , 2013; Деллинг и др., 2013; Фигура 1). Эти белки принадлежат к группе белков, называемых полицистинами, некоторые из которых мутируют у пациентов с поликистозом почек. У мышей мутации PKD1L1 нарушают формирование левого-правого паттерна и вызывают гибель развивающихся эмбрионов (Field et al, 2011). Напротив, мыши с дефицитом PKD2L1 могут выжить, но демонстрируют мальротацию кишечника — состояние, которое заставляет части кишечника развиваться в неправильных положениях (Delling et al., 2013). Группа Clapham продемонстрировала, что каналы PKD1L1-PKD2L1 в цилиарной мембране вызывают концентрацию Ca 2+ в покое, которая примерно в пять раз выше в первичных ресничках, чем в теле клетки.Таким образом, первичные реснички представляют собой специализированную сигнальную органеллу Ca 2+ , в которой Ca 2+ может быть необходим для регуляции sonic hedgehog и других сигнальных путей.

Doerner, Delling и Clapham сделали первые записи патч-зажим на подвижных ресничках. Записи были сделаны на эпендимных клетках, которые выстилают заполненные жидкостью пространства в головном и спинном мозге, и выявили несколько различий между подвижными ресничками и другими типами ресничек. Во-первых, количество каналов Ca 2+ в плазматической мембране подвижных ресничек, по-видимому, намного ниже, чем в первичных ресничках и жгутиках.Только один тип канала Ca 2+ , по-видимому, присутствует в подвижных ресничках эпендимных клеток: потенциал-зависимый канал Ca 2+ (в подсемействе Ca v 1). Более того, ресничная мембрана содержит намного меньше этих каналов, чем плазматическая мембрана остальной части клетки (Рис. 1).

Кроме того, Doerner et al. обнаружили, что концентрация Ca 2+ в подвижных ресничках была намного ниже, чем в первичных ресничках. Наконец, хотя потенциалзависимые каналы Ca 2+ вызывают существенное повышение концентрации Ca 2+ внутри ресничек при деполяризации мембраны, это не меняет подвижность ресничек в заметной степени.Это разительно отличается от жгутика сперматозоидов, где подвижность сильно регулируется движением ионов Ca 2+ через CatSper. Однако остается возможность, что помимо потенциалозависимых каналов Ca 2+ , подвижные реснички содержат др., Но не идентифицированные, типы каналов Ca 2+ , которые будут более эффективными в контроле биения ресничек.

Замечательные технические и концептуальные достижения группы Клэпхэма должны привести к открытию других ионных каналов и новых регуляторных путей в этих удивительных структурах.

Калькулятор гидравлического радиуса

| Смачиваемый периметр

Если вы хотите найти гидравлический радиус в расчетах расхода в трубе, то этот калькулятор гидравлического радиуса — это то, что вам нужно. Мы собрали в общей сложности пять уравнений гидравлического радиуса для различных форм каналов: прямоугольник, трапеция, треугольник и труба с разным уровнем заполнения — этот инструмент определенно не несбыточная мечта!

Войдите и узнайте, в чем разница между диаметром более влажного и гидравлическим радиусом трубы или любой другой формы канала в этом отношении!

Что такое гидравлический радиус?

Гидравлический радиус R определяется как отношение площади поперечного сечения потока, A , к периметру смачиваемого канала, P :

R = A / P

Например, представьте, что у вас есть прямоугольный канал, такой же, как на изображении.Площадь потока будет равна ширине канала b , умноженной на глубину потока, y .

С другой стороны, смоченный периметр — это просто общая длина стенок канала, которые контактируют с жидкостью . В случае прямоугольного канала это сумма b + y + y .

Как рассчитать смоченный периметр трубы?

Смачиваемый периметр трубы — это часть всего периметра трубы, которая контактирует с текущей жидкостью (например, водой).Рассчитать это для полной трубы очень просто — она ​​равна общему периметру трубы:

P = 2πr

Если ваша труба заполнена только наполовину, смоченный периметр будет равен половине всего периметра:

P = πr

Что произойдет, если труба заполнена не совсем или наполовину? В этом случае смоченный периметр равен длине дуги, соответствующей центральному углу θ, как показано на рисунке.

θ = 2 * arccos [(r - h) / r]

P = r * θ

Уравнение гидравлического радиуса для прямоугольного, трапецеидального и треугольного канала

Этот гидравлический калькулятор радиуса может использоваться для каналов различной формы, включая прямоугольники, трапеции и треугольники.Давайте проанализируем их более подробно, чтобы выяснить, какие уравнения гидравлического радиуса можно использовать в каждом конкретном случае.

1. Канал прямоугольный

В случае прямоугольного канала формулы очень просты. Гидравлический радиус просто равен площади прямоугольника, деленной на смоченный периметр, как объяснено в первом примере:

R = A / P = (b * y) / (b + y + y) = (b * y) / (b + 2y)

Вот и все — вы можете использовать эту формулу, чтобы найти гидравлический радиус прямоугольного открытого канала.

2. Канал трапециевидный

Формулы для гидравлического радиуса трапециевидного канала немного сложнее. Для начала вспомним формулу площади трапеции:

A = y * (B + b) / 2

Мы можем упростить эту формулу, используя значение наклона z , определяемое как усиление ширины канала на каждую единицу его глубины (градиент непараллельных сторон трапазоида). Подобно правилу треугольника, увеличение ширины на одной стороне трапеции составляет zy , и, следовательно, B = b + 2zy .Затем

A = by + y²z

Смачиваемый периметр равен b и длинам двух наклонных сторон канала. Используя теорему Пифагора, находим:

P = b + 2 * y * √ (1 + z²)

Отсюда можно сделать вывод, что:

R = A / P = (by + y²z) / [b + 2 * y * √ (1 + z²)]

3. Канал треугольный

Мы можем записать площадь треугольника двумя способами: одним способом, использующим стороны треугольника, и другим, который использует наклон, z :

A = B * y / 2 = y²z

Смоченный периметр треугольника аналогичен периметру трапеции, но на этот раз мы суммируем только наклонные стороны канала:

P = 2 * y * √ (1 + z²)

Наконец, мы приходим к уравнению гидравлического радиуса треугольника:

R = A / P = y²z / [2 * y * √ (1 + z²)] = yz / [2 * √ (1 + z²)]

Гидравлический радиус трубы

Остальные четыре параметра в нашем гидравлическом калькуляторе радиуса помогают анализировать трубы.Поскольку формулы различаются, мы выделили два разных случая: канал заполнен, а другой — меньше, чем заполнен.

1. Труба полная

Нет ничего проще, чем найти гидравлический радиус трубы, полностью заполненной жидкостью. Все, что вам нужно сделать, это использовать формулы для площади и периметра круга!

R = A / P = πr² / 2πr = r / 2

Как видите, гидравлический радиус полной трубы составляет всего половину ее радиуса .

2. Трубка (неполная)

Проблема немного усложняется, когда труба заполнена только частично. Мы уже рассчитали этот смачиваемый периметр по смачиваемому периметру участка трубы:

P = r * θ , где центральный угол θ = 2 * arccos [(r - h) / r]

А что насчет области тогда? Вы можете использовать формулу для площади сегмента круга:

A = r² * (θ - sin (θ)) / 2

Комбинируя эти два, мы находим уравнение гидравлического радиуса:

R = A / P = [r² * (θ - sin (θ)) / 2] / (r * θ)

Это настоящая формула! К счастью, вы можете использовать этот удобный гидравлический калькулятор радиуса вместо того, чтобы тщательно выполнять все вычисления вручную;)

% PDF-1.6
%
18911 0 объектов>
эндобдж

xref
18911 121
0000000016 00000 н.
0000008207 00000 н.
0000008377 00000 н.
0000008747 00000 н.
0000008932 00000 н.
0000009119 00000 п.
0000009360 00000 п.
0000009703 00000 п.
0000009950 00000 н.
0000010260 00000 п.
0000011941 00000 п.
0000012121 00000 п.
0000012357 00000 п.
0000012929 00000 п.
0000012982 00000 п.
0000013346 00000 п.
0000013399 00000 п.
0000023238 00000 п.
00000

00000 н.
00000

00000 п.
0000090933 00000 п.
0000091018 00000 п.
0000091063 00000 п.
0000091163 00000 п.
0000091208 00000 п.
0000091308 00000 п.
0000091353 00000 п.
0000091453 00000 п.
0000091498 00000 п.
0000091598 00000 п.
0000091643 00000 п.
0000091743 00000 п.
0000091788 00000 п.
0000091888 00000 п.
0000091933 00000 п.
0000092035 00000 п.
0000092080 00000 п.
0000092243 00000 п.
0000092330 00000 п.
0000092375 00000 п.
0000092479 00000 п.
0000092658 00000 п.
0000092869 00000 п.
0000092914 00000 п.
0000093040 00000 п.
0000093185 00000 п.
0000093276 00000 п.
0000093321 00000 п.
0000093407 00000 п.
0000093557 00000 п.
0000093648 00000 п.
0000093692 00000 п.
0000093778 00000 п.
0000093922 00000 н.
0000094011 00000 п.
0000094055 00000 п.
0000094153 00000 п.
0000094295 00000 п.
0000094339 00000 п.
0000094443 00000 п.
0000094487 00000 п.
0000094592 00000 п.
0000094635 00000 п.
0000094742 00000 п.
0000094785 00000 п.
0000094829 00000 н.
0000094941 00000 п.
0000094985 00000 п.
0000095029 00000 п.
0000095074 00000 п.
0000095239 00000 п.
0000095339 00000 п.
0000095383 00000 п.
0000095499 00000 п.
0000095669 00000 п.
0000095777 00000 п.
0000095821 00000 п.
0000095919 00000 п.
0000095963 00000 п.
0000096096 00000 п.
0000096140 00000 п.
0000096272 00000 н.
0000096316 00000 п.
0000096360 00000 п.
0000096405 00000 п.
0000096526 00000 п.
0000096571 00000 п.
0000096713 00000 п.
0000096758 00000 н.
0000096802 00000 п.
0000096846 00000 п.
0000096891 00000 п.
0000097056 00000 п.
0000097156 00000 п.
0000097201 00000 п.
0000097317 00000 п.
0000097362 00000 п.
0000097474 00000 п.
0000097519 00000 п.
0000097661 00000 п.
0000097706 00000 п.
0000097751 00000 п.
0000097796 00000 п.
0000097841 00000 п.
0000097960 00000 н.
0000098005 00000 п.
0000098255 00000 п.
0000098300 00000 п.
0000098482 00000 н.
0000098527 00000 п.
0000098753 00000 п.
0000098798 00000 п.
0000098843 00000 п.
0000098888 00000 п.
0000099017 00000 н.
0000099062 00000 н.
0000099167 00000 п.
0000099212 00000 н.
0000099257 00000 н.
0000007720 00000 н.
0000002773 00000 н.
трейлер
] >>
startxref
0
%% EOF

19031 0 obj> поток
xYyXSW? f! ! HZR «& nluAQ6 (ȢҨť6 * n]> vj {nb; 31 ̕ {rwO

Прямая vs.Косвенный канал распространения: в чем разница?

Прямые и косвенные каналы сбыта: обзор

Канал сбыта — это цепочка предприятий или посредников, через которую проходит товар или услуга, пока не достигнет конечного потребителя. Каналы делятся на прямые и косвенные.

Каналы распространения могут включать производителя, склады, центры доставки, розничных продавцов и даже Интернет. Прямые каналы позволяют покупателю покупать товары напрямую у производителя, в то время как косвенные каналы перемещают продукт через другие каналы распределения, чтобы добраться до потребителя.

Фирмы, использующие прямую дистрибуцию, нуждаются в собственных логистических командах и транспортных средствах. Те, у кого есть косвенные каналы сбыта, должны установить отношения со сторонними системами продаж.

Производимые товары и услуги должны найти способ добраться до потребителей. Роль канала распределения заключается в эффективной передаче товаров и услуг. Их можно отправить в розничный магазин или прямо к покупателю.

У прямых каналов сбыта есть свои преимущества и недостатки.То же самое и с косвенными каналами. Работа менеджеров и других лиц, участвующих в корпоративном управлении, заключается в том, чтобы найти наиболее эффективные средства, основанные на конкретных потребностях фирмы.

В чем разница между прямым и косвенным каналом распространения?

Прямое распространение

Прямой канал сбыта организован и управляется самим производителем. Прямые каналы, как правило, дороже на начальном этапе и иногда могут потребовать значительных капиталовложений.Необходимо будет создать склады, логистические системы, грузовики и сотрудников службы доставки. Однако, как только они будут созданы, прямой канал, вероятно, будет короче и дешевле, чем косвенный канал.

Прямыми продажами сложно управлять в крупных масштабах, но они часто позволяют производителю лучше поддерживать связь со своей потребительской базой.

Контролируя все аспекты канала сбыта, производитель имеет больше контроля над доставкой товаров.У них больше контроля над сокращением неэффективности, добавлением новых услуг и установлением цен.

Косвенное распространение

Косвенный канал распределения полагается на посредников для выполнения большинства или всех функций распределения, иначе известный как оптовый сбыт. Самая сложная часть косвенных каналов сбыта заключается в том, что другая сторона должна доверять продукты производителя и взаимодействие с клиентами. Однако наиболее успешные логистические компании являются экспертами в доставке дебиторской задолженности так, как это не может сделать большинство производителей.

Косвенные каналы также освобождают производителя от любых начальных затрат. При правильных отношениях ими намного проще управлять, чем прямыми каналами сбыта. Косвенные каналы распространения добавляют уровни затрат, поставщиков и бюрократии. Это может увеличить стоимость для потребителя, замедлить доставку и вывести контроль из рук производителя. С другой стороны, непрямое распространение может принести новый уровень знаний. Компания-производитель не является судоходной компанией.Хотя компания может быть экспертом в производстве определенного товара, его эффективная доставка — это другая область знаний. Компания может сосредоточиться на своей основной компетенции, отдавая свои услуги доставки компании, которая занимается исключительно этим.

Ключевые выводы

  • Прямое распространение — это подход напрямую к потребителю, при котором производитель контролирует все аспекты распространения.
  • В косвенном распространении участвуют третьи стороны, такие как склады, оптовые и розничные торговцы.
  • Прямое распределение дает компаниям больше контроля над всем процессом.
  • Косвенное распространение может позволить компаниям сосредоточиться на своей основной деятельности, передавая распределение на аутсорсинг эксперту.

На пути к успеху

Канал является мощным, но часто упускаемым из виду графическим паттерном и сочетает в себе несколько форм технического анализа, чтобы предоставить трейдерам потенциальные точки для входа и выхода из сделок, а также для контроля риска. Первый шаг — научиться определять каналы.Следующие шаги включают определение, где и когда входить в сделку, где размещать стоп-лосс и где фиксировать прибыль.

Ключевые выводы

  • Торговые каналы могут быть нарисованы на графиках, чтобы помочь увидеть восходящие и нисходящие тенденции по акциям, товарам, ETF или валютной паре.
  • Трейдеры также используют каналы для определения потенциальных точек покупки и продажи, а также для установки целевых цен и точек стоп-лосса.
  • Восходящие каналы наклоняются вверх во время восходящего тренда, а нисходящие каналы наклоняются вниз во время нисходящего тренда.
  • Другие технические индикаторы, такие как объем, могут усилить сигналы, генерируемые торговыми каналами.
  • Как долго длился канал, поможет определить основную силу тренда.

Характеристики канала

В контексте технического анализа канал возникает, когда цена актива движется между двумя параллельными линиями тренда. Верхняя линия тренда соединяет максимумы колебания цены, а нижняя линия тренда соединяет минимумы колебания.На графике канал может наклоняться вверх, вниз или в сторону.

Если цена вырывается из торгового канала вверх, движение может указывать на дальнейшее ралли цены. Например, на диаграмме ниже показан канал и прорыв акций Hyatt Hotels Corporation (H). С другой стороны, если цена пробивается ниже дна канала, падение указывает на то, что на подходе могут быть новые продажи.

Техника торгового канала часто лучше всего работает с акциями со средней волатильностью, что может быть важно при определении размера прибыли, возможной от сделки.Например, если волатильность низкая, тогда канал не будет очень большим, что означает меньшую потенциальную прибыль. Более крупные каналы обычно связаны с большей волатильностью, что означает большую потенциальную прибыль.

Типы каналов

Канал состоит как минимум из четырех точек контакта, потому что нам нужно как минимум два минимума для соединения друг с другом и два максимума для соединения друг с другом. Вообще говоря, есть три типа:

  1. Каналы, расположенные под углом вверх, называются восходящими каналами.
  2. Каналы, расположенные под углом вниз, являются нисходящими каналами. Восходящие и нисходящие каналы также называются каналами тренда, потому что цена движется преимущественно в одном направлении.
  3. Каналы, в которых линии тренда расположены горизонтально, называются горизонтальными каналами, торговыми диапазонами или прямоугольниками.

Изображение Джули Банг © Investopedia 2020

Покупка или продажа канала

Каналы иногда могут предоставлять точки покупки и продажи, и есть несколько правил для открытия длинных или коротких позиций:

  • Когда цена достигает вершины канала, продайте существующую длинную позицию и / или откройте короткую позицию.
  • Когда цена находится в середине канала, ничего не делайте, если у вас нет сделок, или удерживайте текущие сделки.
  • Когда цена достигает дна канала, закройте существующую короткую позицию и / или откройте длинную позицию.

Из этих правил есть два исключения:

  1. Если цена пробивает верхнюю или нижнюю границы канала, значит, канал больше не является целым. Не начинайте больше сделок, пока не разовьется новый канал.
  2. Если цена дрейфует между каналами в течение длительного периода времени, может быть установлен новый более узкий канал.В этот момент входите или выходите около крайних точек более узкого канала.

Во время восходящего канала сосредоточьтесь на покупке около дна канала и выходе около его вершины. Остерегайтесь коротких продаж, поскольку тренд восходящий. Например, восходящий канал показан ниже в акциях NVIDIA Corporation (NVDA).

Во время нисходящего канала сосредоточьтесь на коротких продажах в верхней части канала и выходе в нижней части. Остерегайтесь открывать длинные позиции в нисходящем канале, поскольку тренд нисходящий.

Иногда используются другие формы технического анализа для повышения точности сигналов из канала и проверки общей силы движения вверх или вниз. Некоторые другие инструменты, которые можно использовать при торговле по каналам, включают:

  • Дивергенция конвергенции скользящих средних (MACD) часто бывает близкой к нулю во время горизонтальных каналов. Линия MACD, пересекающая сигнальную линию, также может указывать на потенциальные длинные сделки в нижней части канала или короткие в верхней части канала.
  • Стохастическое пересечение может также сигнализировать о возможности покупки около дна канала или возможности продажи около вершины.
  • Объем также может помочь в торговых каналах. Громкость каналов часто ниже, особенно в середине канала. Прорывы часто связаны с большим объемом. Если объем не увеличивается при прорыве, существует большая вероятность продолжения канала.

Определение уровней стоп-лосса и тейк-профита

Каналы могут предоставлять встроенные возможности управления капиталом в виде уровней стоп-лосса и тейк-профита.Вот основные правила определения этих точек:

  • Если вы купили в нижней части канала, выйдите и зафиксируйте прибыль в верхней части канала, но также установите стоп-лосс немного ниже нижней границы канала, оставляя место для постоянной волатильности.
  • Если вы открыли короткую позицию в верхней части канала, выходите и фиксируйте прибыль в нижней части канала. Кроме того, установите стоп-лосс немного выше верхней границы канала, чтобы оставить место для постоянной волатильности.Вот нисходящий канал в BCE Inc. (BCE) вместе с потенциальными стоп-лоссами и точками выхода.

Определение торговой надежности

Каналы дают возможность определить вероятность успеха сделки. Это делается с помощью так называемых подтверждений. Подтверждения представляют количество раз, когда цена отскакивала от вершины или основания канала. Это важные уровни подтверждения, о которых следует помнить:

  • 1-2: Слабый канал (нельзя обменять)
  • 3-4: Адекватный канал (торгуется)
  • 5-6: Сильный канал (надежный)
  • 6 +: Очень сильный канал (более надежный)

Оценка длины сделки

Время, необходимое сделке для достижения точки продажи от точки покупки, также можно рассчитать с помощью каналов.Это делается путем записи количества времени, которое потребовалось для совершения сделок в прошлом, с последующим усреднением этого количества времени на будущее. Эта оценка основана на предположении, что движение цен примерно одинаково с точки зрения времени и цены. Однако это только приблизительная оценка и не всегда может быть точной.

Торговые каналы могут выглядеть по-разному в зависимости от выбранного таймфрейма. Например, канал на недельном графике может не отображаться на дневном графике.

Итог

Каналы предоставляют один из способов покупки и продажи, когда цена движется между линиями тренда.«Обложив» движение цены акции двумя параллельными линиями, можно оценить сигналы покупки и продажи, а также стоп-лосс и целевые уровни. Продолжительность существования канала помогает определить его силу. Количество времени, которое обычно требуется цене, чтобы перейти от максимума к минимуму (или от минимума к максимуму), позволяет оценить, как долго могут длиться сделки.

.

Related Posts

Добавить комментарий

Ваш адрес email не будет опубликован.